View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5911_low_31 (Length: 261)

Name: NF5911_low_31
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5911_low_31
NF5911_low_31
[»] chr8 (1 HSPs)
chr8 (14-261)||(43451860-43452107)


Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 43451860 - 43452107
Alignment:
14 aggccactgttgatgggatgattggcgagttacgctgtgcaatcaataacctgtacatgtcagagattctccaggaatctgaaatggcggctcttcaaat 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451860 aggccactgttgatgggatgattggcgagttacgctgtgcaatcaataacctgtacatgtcagagattctccaggaatctgaaatggcggctcttcaaat 43451959  T
114 agagaagttgtggagaggagggaatctgggagtggatatccacagcatgctatcaaaacctccaattattaatgggtttgtggagatacttttcaattct 213  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43451960 agagaaattgtggagaggagggaatctgggagtggatatccacagcatgctatcaaaacctccaattattaatgggtttgtggagatacttttcaattct 43452059  T
214 gttgaaccccaggttcttcaggcagcagttttccttctggctgagatg 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
43452060 gttgaaccccaggttcttcaggcagcagttttccttctggctgagatg 43452107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University