View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_low_36 (Length: 251)
Name: NF5911_low_36
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 64 - 239
Target Start/End: Original strand, 5856329 - 5856504
Alignment:
| Q |
64 |
acacgtgtatgttaacatttttaaaagggaagaaattgcagagggagtagtacttagactttcttccttcaaatttcaccacataatgcgttaattttga |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5856329 |
acacgtgtatgttaacatttttaaaagggaagaaattgcacagggagtagtacttagactttcttccgtcaaatttcaccacataatgcgttaattttga |
5856428 |
T |
 |
| Q |
164 |
caaatatcaaaaacatattaaacgatcttaaatttttataaacttttttatcgatgatgtataatataaactttca |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5856429 |
caaatatcaaaaacatattaaacgatcttaaatttttataaacttttttattgatgatgtataatataaactttca |
5856504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 13 - 72
Target Start/End: Original strand, 5856055 - 5856114
Alignment:
| Q |
13 |
aatatggagggttttgttggttaaaaattgtggtacgatttgaaaaattctacacgtgta |
72 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5856055 |
aatatggagggttttgttggtcaaaaattgtggtacaatttgaaaaattctacacgtgta |
5856114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University