View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5911_low_43 (Length: 248)
Name: NF5911_low_43
Description: NF5911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5911_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 782946 - 783175
Alignment:
| Q |
1 |
ctctcaaacccatcaagttcacaacaaaaacaacaaaaatctcagctgcagatgagaaaacagaagcagcatcagttacaacaaaagaagaagctcctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
782946 |
ctctcaaacccatcaagttcacaacaaaaacaacaaaaatctcagctgcagatgagaaaacagaagcagcatcagttacaacaaaagaagaagctcctgc |
783045 |
T |
 |
| Q |
101 |
tgcaccagttggtttcactccacctgaactagacccaaacacaccttcaccaatctttggaggaagcactggtggattgttacgtaaggcacaagttgaa |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783046 |
tgcaccagttggttttactccacctgaactagacccaaacacaccttcaccaatctttggaggaagcactggtggattgttacgtaaggcacaagttgaa |
783145 |
T |
 |
| Q |
201 |
gaattctatgtgatcacatgggagtcacct |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
783146 |
gaattctatgtgatcacatgggagtcacct |
783175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 229
Target Start/End: Complemental strand, 47124089 - 47124040
Alignment:
| Q |
180 |
ttacgtaaggcacaagttgaagaattctatgtgatcacatgggagtcacc |
229 |
Q |
| |
|
||||| ||||| |||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
47124089 |
ttacgcaaggcccaagttgaagaatttcatgtgatcacatgggattcacc |
47124040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University