View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5913_low_10 (Length: 291)
Name: NF5913_low_10
Description: NF5913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5913_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 260
Target Start/End: Complemental strand, 36571671 - 36571425
Alignment:
| Q |
14 |
caaaatcatccactacaatccaacttttgattaagcaaaacagttaggagtatcatacttttcattcatcatgtgttggaaaaaggacctcctttgctaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571671 |
caaaatcatccactacaatccaacttttgattaatcaaaacagttaggagtatcatacttttcattcatcatgtgttggaaaaaggacctcctttgctaa |
36571572 |
T |
|
| Q |
114 |
catctatggaaaacgatgcattagtccatctgtatgtgcatatcctccaatgaatacacttccaaattgcggtaacatcggtattggactttatagtgac |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571571 |
catctatggaaaacgatgcattagtccatctgtatgtgcatatcctccaatggatacacttccaaattgcggtaacatcggtattggactttatagtgac |
36571472 |
T |
|
| Q |
214 |
aagaaatttcaaagtaacatcctttgattagactttgcctctttatc |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36571471 |
aagaaatttcaaagtaacatcctttgattagactttgcctctttatc |
36571425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University