View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5913_low_15 (Length: 230)
Name: NF5913_low_15
Description: NF5913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5913_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 45371166 - 45371393
Alignment:
| Q |
1 |
acacaattcccttttgcgactatgttgttggacatggaggattttggacaagttggaggcaggtagagtagatgtttgtttgaataaggaatccaataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45371166 |
acacaattcccttttgcgactatgttgttggacatggaggattttggacaagttggaggcaggtagagtagatgtttgtttgaataaggaatccaataac |
45371265 |
T |
 |
| Q |
101 |
caaacttcatataaaggtggaatctaatcaattacatccttttttatacataataataaagagttattgtttgttttca-nnnnnnnattttcggctggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
45371266 |
taaacttcatataaaggtggaatctaatcaattacatccttttttacacataataataaagagtta---tttgttttcattttttttattttcggctggt |
45371362 |
T |
 |
| Q |
200 |
agttacttgctgttggtggcctcaggatctt |
230 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |
|
|
| T |
45371363 |
agttacttgctggtggtggcctcaggatctt |
45371393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University