View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5915-Insertion-1 (Length: 1018)
Name: NF5915-Insertion-1
Description: NF5915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5915-Insertion-1 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0056 (3 HSPs) |
 |  |  |
|
| [»] scaffold0026 (2 HSPs) |
 |  |  |
|
| [»] scaffold0065 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold1001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (2 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0160 (2 HSPs) |
 |  |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |  |
|
| [»] scaffold0684 (2 HSPs) |
 |  |  |
|
| [»] scaffold0535 (2 HSPs) |
 |  |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0811 (2 HSPs) |
 |  |  |
|
| [»] scaffold0712 (1 HSPs) |
 |  |  |
|
| [»] scaffold0709 (1 HSPs) |
 |  |  |
|
| [»] scaffold0373 (1 HSPs) |
 |  |  |
|
| [»] scaffold0370 (1 HSPs) |
 |  |  |
|
| [»] scaffold0159 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (2 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0176 (2 HSPs) |
 |  |  |
|
| [»] scaffold0051 (2 HSPs) |
 |  |  |
|
| [»] scaffold0326 (4 HSPs) |
 |  |  |
|
| [»] scaffold0347 (2 HSPs) |
 |  |  |
|
| [»] scaffold0337 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0166 (1 HSPs) |
 |  |  |
|
| [»] scaffold0123 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0105 (1 HSPs) |
 |  |  |
|
| [»] scaffold0060 (2 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 2e-61; HSPs: 218)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 2e-61
Query Start/End: Original strand, 210 - 447
Target Start/End: Original strand, 8518488 - 8518725
Alignment:
| Q |
210 |
aatattctaataaccatcatttgttttctaagtcatctatattataatgacttttccaactctttcaagattaaattggctaaaaattatggttgtacat |
309 |
Q |
| |
|
|||||| |||||| |||| || |||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
8518488 |
aatattgtaataagcatcgttcattttctaaatcatctacattataatgacttttccaactctttcaagattattttggctaaaaattgtggttgtacat |
8518587 |
T |
 |
| Q |
310 |
tgacattgacttatgagnnnnnnnctcatagtccattgacttatgacttttctatagctcattggttggtttaattttttcttcttaactgatcggtttg |
409 |
Q |
| |
|
||||||||||||||| ||| ||| |||| ||||||||||||||||| |||||||||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
8518588 |
ccacattgacttatgagtttttt-ctcctagcccatcgacttatgacttttctacagctcattggttcgtttaattttttcttcctaactgattggtttg |
8518686 |
T |
 |
| Q |
410 |
atttttcatctcac-atttcttccccatcatattgttac |
447 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||| |
|
|
| T |
8518687 |
atttatcatctcacaatttcttccccttcatattgttac |
8518725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 233 - 447
Target Start/End: Original strand, 8530012 - 8530229
Alignment:
| Q |
233 |
ttttctaagtcatctatattataatgac----ttttccaactctttcaagattaaattggctaaaaa-ttatggttgtacattgacattgacttatgagn |
327 |
Q |
| |
|
|||||||| ||||||||||| ||||||| |||||||||||||||| ||||| |||||||||||| || ||||||| ||| ||||||||||||||| |
|
|
| T |
8530012 |
ttttctaactcatctatattgtaatgaccgacttttccaactctttcaggattacattggctaaaaaattgtggttgtgcatccacattgacttatgagt |
8530111 |
T |
 |
| Q |
328 |
nnnnnnctcatagtccattgacttatgacttttctatagctcattggttggtttaattttttcttcttaactgatcggtttgatttttcatctcac-att |
426 |
Q |
| |
|
|| ||| |||||||||||||||||| |||| ||||||||||||||||||||| || ||| |||||||| ||||| |||||||||||||| ||| |
|
|
| T |
8530112 |
tttt---tcctagcccattgacttatgactttactattgctcattggttggtttaatttatttttcctaactgattggttttatttttcatctcacaatt |
8530208 |
T |
 |
| Q |
427 |
tcttccccatcatattgttac |
447 |
Q |
| |
|
|||||||| || ||| ||||| |
|
|
| T |
8530209 |
tcttccccttcgtatagttac |
8530229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 61; E-Value: 1e-25
Query Start/End: Original strand, 515 - 618
Target Start/End: Original strand, 8518793 - 8518897
Alignment:
| Q |
515 |
taaaacttattttgatccctgaaaagttaagcaatttagtatcaaagaaaaatagattgtgtcaatttggtccttcaatcgaaccaaattactc-ctctc |
613 |
Q |
| |
|
||||| ||| |||||||||||| || ||||||||||||||||||| ||||||||||||||||||| ||||| |||||||| |||||||||| || ||||| |
|
|
| T |
8518793 |
taaaatttaatttgatccctgacaaattaagcaatttagtatcaatgaaaaatagattgtgtcaacttggttcttcaatcaaaccaaattaatctctctc |
8518892 |
T |
 |
| Q |
614 |
tctct |
618 |
Q |
| |
|
||||| |
|
|
| T |
8518893 |
tctct |
8518897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 47336226 - 47336287
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47336226 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
47336287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 802 - 866
Target Start/End: Original strand, 15979333 - 15979397
Alignment:
| Q |
802 |
tgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15979333 |
tgaatggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
15979397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 26089730 - 26089789
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26089730 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
26089789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 54608515 - 54608577
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54608515 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
54608577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 1721454 - 1721397
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1721454 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1721397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 28452377 - 28452317
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28452377 |
aggctaaaatatggttttggtccctacaaatatgcttcgttttggttttagtccctgcaaa |
28452317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 28552384 - 28552324
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28552384 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
28552324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 46622130 - 46622074
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46622130 |
aggctaaaatatggttttggtccttgcaaatatgtttcgttttggttttagtccctg |
46622074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 51550081 - 51550141
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51550081 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
51550141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 805 - 860
Target Start/End: Original strand, 14772209 - 14772264
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14772209 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
14772264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 22008890 - 22008831
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22008890 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
22008831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 8940528 - 8940466
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8940528 |
aaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
8940466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 25615972 - 25616030
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25615972 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25616030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 31480133 - 31480191
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
31480133 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
31480191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 32119587 - 32119525
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32119587 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
32119525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 43441606 - 43441544
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43441606 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaa |
43441544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 474042 - 474103
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
474042 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
474103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 5345691 - 5345634
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5345691 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
5345634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 9597097 - 9597040
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9597097 |
aaggctaaaatatggttttgttccctgcaaatatgcttcgttttggttttagtccctg |
9597040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 801 - 862
Target Start/End: Complemental strand, 19844587 - 19844526
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
19844587 |
ttgaaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
19844526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 9262156 - 9262096
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
9262156 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccgcaaa |
9262096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 12740906 - 12740966
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12740906 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
12740966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 802 - 866
Target Start/End: Complemental strand, 40370594 - 40370530
Alignment:
| Q |
802 |
tgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
40370594 |
tgaacggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccccgcaaa |
40370530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 45002020 - 45002080
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
45002020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaa |
45002080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 51834943 - 51834887
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
51834943 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
51834887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 31480500 - 31480441
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31480500 |
ggctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
31480441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 45313863 - 45313808
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
45313863 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttgattttagtccctg |
45313808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 49323782 - 49323837
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
49323782 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
49323837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 4950034 - 4950092
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4950034 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4950092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 12741274 - 12741216
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
12741274 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12741216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 29678021 - 29678079
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
29678021 |
aaaggctaaaatatagttttggtctttgcaaatatgcctcgttttggttttagtccctg |
29678079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 37507225 - 37507167
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37507225 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37507167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 40277819 - 40277877
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
40277819 |
aaaggctaaaatgtggttttggtccctgcaaatatgcttcgttttggttttactccctg |
40277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 45002388 - 45002330
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45002388 |
aaaggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
45002330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 858
Target Start/End: Complemental strand, 46186774 - 46186720
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
46186774 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
46186720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 4513261 - 4513318
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4513261 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
4513318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 20611018 - 20611071
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
20611018 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
20611071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 20612900 - 20612843
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
20612900 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
20612843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 28427610 - 28427553
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28427610 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28427553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 39437111 - 39437054
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39437111 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
39437054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 48924242 - 48924185
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
48924242 |
aaggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
48924185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 51834606 - 51834663
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
51834606 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51834663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 474409 - 474349
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
474409 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaa |
474349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 3152112 - 3152056
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3152112 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3152056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 28552020 - 28552076
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28552020 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctg |
28552076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 30034473 - 30034417
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30034473 |
aggctaaaatatggttttgctccttgcaaatatgtctcgttttggttttagtccctg |
30034417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 30106221 - 30106165
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
30106221 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
30106165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 37506866 - 37506922
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37506866 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37506922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 47336582 - 47336526
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
47336582 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47336526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 51500686 - 51500626
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||| | |||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51500686 |
aggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
51500626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 51550447 - 51550391
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
51550447 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
51550391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 54608864 - 54608808
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
54608864 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
54608808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 3151749 - 3151804
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
3151749 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3151804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 3387607 - 3387552
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3387607 |
aaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtcc |
3387552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 4034717 - 4034772
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4034717 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4034772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 7957226 - 7957171
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7957226 |
ggctaaaatatgattttggtccctgcaaatatgcgtcgttttggttttagtccctg |
7957171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 9261789 - 9261844
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9261789 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
9261844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 9603628 - 9603683
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
9603628 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccct |
9603683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 10976978 - 10977033
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10976978 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
10977033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 25710870 - 25710815
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25710870 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
25710815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 26090078 - 26090023
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26090078 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
26090023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 746 - 805
Target Start/End: Complemental strand, 26536553 - 26536494
Alignment:
| Q |
746 |
aaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
26536553 |
aaaatatttttttaacagaatatttatataaaatcaattttgtggagaccaaaacttgaa |
26536494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 34238918 - 34238863
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
34238918 |
aaaggctaaaatatggttttagtccccgcaaatatgcttcgttttggttttagtcc |
34238863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 43441270 - 43441329
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
43441270 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaa |
43441329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 863655 - 863597
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| ||||||||| |||||||||||| |
|
|
| T |
863655 |
aaaggttaaaatatggttttggtccctgcaaatatgtttcgttttgattttagtccctg |
863597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 809 - 855
Target Start/End: Complemental strand, 2486900 - 2486854
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2486900 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggtttta |
2486854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 11463233 - 11463287
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11463233 |
gctaaaatatggttttggttcctgcaaatatgcctcgttttggttttagtccctg |
11463287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 13584370 - 13584312
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
13584370 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
13584312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 22156292 - 22156238
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
22156292 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22156238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 26799885 - 26799943
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
26799885 |
aaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
26799943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 35565505 - 35565563
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
35565505 |
aaaggctaaaatatggttttgttccctgcaaatatacctcgttttggttttagtccctg |
35565563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 39436715 - 39436773
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
39436715 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39436773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 3830517 - 3830464
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3830517 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
3830464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 810 - 859
Target Start/End: Complemental strand, 8555305 - 8555256
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
8555305 |
taaaatatggttttggtccatgcaaatatgcatcgttttggttttagtcc |
8555256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 858
Target Start/End: Original strand, 16679678 - 16679727
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
16679678 |
ctaaaatatggttttagtccttgaaaatatgcttcgttttggttttagtc |
16679727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 21553887 - 21553944
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||| ||||||| ||||| |
|
|
| T |
21553887 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagcccctg |
21553944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 22008524 - 22008581
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
22008524 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22008581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 22016042 - 22016099
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
22016042 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
22016099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 28452146 - 28452199
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
28452146 |
aggctaaaatatggttttggtccttgcaaatatgtcttgttttggttttagtcc |
28452199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 28942907 - 28942850
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28942907 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
28942850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 30268503 - 30268560
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30268503 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30268560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 35569138 - 35569081
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35569138 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35569081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 804 - 861
Target Start/End: Original strand, 43440492 - 43440549
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
43440492 |
aaaggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccct |
43440549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 45320981 - 45320924
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45320981 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
45320924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 47005152 - 47005209
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
47005152 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagtccctg |
47005209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 47005520 - 47005467
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
47005520 |
aggctaaaatatggttttggtccctgcaaatattcctcgttttggttttagtcc |
47005467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 801 - 866
Target Start/End: Complemental strand, 49324152 - 49324087
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||| ||| ||||||||||||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
49324152 |
ttgataggataaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaa |
49324087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 50196301 - 50196354
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
50196301 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
50196354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 275443 - 275503
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||| |||||||| |||||||||||||||| |
|
|
| T |
275443 |
aggctaaaatatggttttagtccctgcaactatgcctcgttttgattttagtccctgcaaa |
275503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 1721092 - 1721144
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
1721092 |
taaaatatggttttggtccttgcaaatatgtctcattttggttttagtccctg |
1721144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 3830133 - 3830189
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
3830133 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
3830189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 15286155 - 15286207
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
15286155 |
aggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtc |
15286207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 15979702 - 15979646
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
15979702 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
15979646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 20405224 - 20405168
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
20405224 |
aggctaaaatatggttttggtccctgcaaatatactttgttttagttttagtccctg |
20405168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 21159818 - 21159762
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
21159818 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
21159762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 25609766 - 25609822
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| || |||||| || ||||||||||||||||||||| |
|
|
| T |
25609766 |
aggctaaaatatggttttggtctttacaaataagcctcgttttggttttagtccctg |
25609822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 29490744 - 29490692
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
29490744 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
29490692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 32119219 - 32119279
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
32119219 |
aggctaaaatatagttttggtccctgcaaatatgtctcgttttagttttagtccctgcaaa |
32119279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 39288899 - 39288843
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39288899 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
39288843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 40545563 - 40545619
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
40545563 |
aggctaaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
40545619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 49670803 - 49670747
Alignment:
| Q |
807 |
ggctaaaatatggttttggtcct-tgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49670803 |
ggctaaaatatggttttagtcccctgcaaatatgcttcgttttggttttagtccctg |
49670747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 4035053 - 4034998
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
4035053 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagttcctg |
4034998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 8510214 - 8510269
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
8510214 |
ggctaaaatatggttttagtccctgcaaatatgcctctttttggttttagtccctg |
8510269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 9863404 - 9863349
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9863404 |
ggctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
9863349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 15016388 - 15016443
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
15016388 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
15016443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 16123139 - 16123194
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
16123139 |
ggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
16123194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 19656538 - 19656593
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
19656538 |
aaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtcc |
19656593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 808 - 859
Target Start/End: Complemental strand, 25610129 - 25610078
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
25610129 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtcc |
25610078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 29445954 - 29446009
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29445954 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29446009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 863
Target Start/End: Complemental strand, 30552481 - 30552422
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgc |
863 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30552481 |
aaaggctaaaatatcgttttagtccatgcaaatatgtctcgttttggttttagtccctgc |
30552422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 805 - 860
Target Start/End: Original strand, 35936778 - 35936833
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||||||||||||| |||| |
|
|
| T |
35936778 |
aaggctaaaatatggttttggtccctacaaatatacttcgttttggttttaatccc |
35936833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 44802282 - 44802337
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
44802282 |
ggctaaaatatggttttagtccctgcaaatatgcgtcgttttggttttagttcctg |
44802337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 50009284 - 50009229
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
50009284 |
ggctaaactatggttttggtccttgcaaatatgcctcgttttgattttaatccctg |
50009229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 53701663 - 53701608
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
53701663 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
53701608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 9596759 - 9596813
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9596759 |
gctaaaatatggtttttgtctctgcaaatatgcatcgttttggttttagtccctg |
9596813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 10977344 - 10977286
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10977344 |
aaaggctaaaatatggatttaatccctgcaaatatgcctcgttttggttttagtccctg |
10977286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 12673641 - 12673699
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
12673641 |
aaaggctaaaatatagttttagtccctgtaaatatgcctcgttttggttttagtccctg |
12673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 14633542 - 14633600
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
14633542 |
aaagactaaaatatggttttagtccctgcaaatatgcctcgttttggttttaggccctg |
14633600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 28418899 - 28418845
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || |||||| |||||||||||| |
|
|
| T |
28418899 |
gctaaaatatggttttggtccctgcaaatatgttttgttttgattttagtccctg |
28418845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 809 - 855
Target Start/End: Original strand, 30034109 - 30034155
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
30034109 |
ctaaaatatggttttggtccttgtaaatatgcctcgttttggtttta |
30034155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 46751269 - 46751323
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
46751269 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
46751323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 47114484 - 47114538
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
47114484 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
47114538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 52342585 - 52342531
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52342585 |
aaggctaaaatatggtttttgtctctgcaaatatgcctcgttttggttttagtcc |
52342531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 3387263 - 3387320
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3387263 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
3387320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 4513622 - 4513565
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4513622 |
aaggctaaaatatggttttactccctgcaaatatgtctcgttttggttttagtccctg |
4513565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 813 - 862
Target Start/End: Complemental strand, 8510523 - 8510474
Alignment:
| Q |
813 |
aatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8510523 |
aatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
8510474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 855
Target Start/End: Complemental strand, 9603920 - 9603871
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
9603920 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggtttta |
9603871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 29686542 - 29686599
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
29686542 |
aaggctagaatatggttttggtccatgcaaatatgtcttgttttggttttagtccctg |
29686599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 29955300 - 29955353
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
29955300 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
29955353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 30004454 - 30004507
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
30004454 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30004507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 34238597 - 34238650
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
34238597 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34238650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 804 - 857
Target Start/End: Original strand, 35177252 - 35177305
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
35177252 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagt |
35177305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 39288571 - 39288624
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
39288571 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
39288624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 45521838 - 45521781
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
45521838 |
aaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
45521781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 855
Target Start/End: Original strand, 52342194 - 52342243
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
52342194 |
aggctaaaatatggttttggtccctgcaaatatgcctccttttggtttta |
52342243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 4814900 - 4814845
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
4814900 |
aaggctaaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtccct |
4814845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 7588317 - 7588369
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||| | ||||||||||||||| |
|
|
| T |
7588317 |
aggctaaaatatagttttggtccctgcaaatatgccttgttttggttttagtc |
7588369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 805 - 865
Target Start/End: Complemental strand, 11312570 - 11312510
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
11312570 |
aaggctaaaatatggcattggtccatgcaaatatgttcagttttggttttagtccctgcaa |
11312510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 22155928 - 22155984
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
22155928 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22155984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 27681683 - 27681627
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
27681683 |
aggctaaaatatggttctggtctctgcaaatatgcctcgttttggttttaatccctg |
27681627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 28427244 - 28427300
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||||||||||||| |
|
|
| T |
28427244 |
aggctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtccctg |
28427300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 29955667 - 29955611
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
29955667 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
29955611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 30004822 - 30004766
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
30004822 |
aggcttaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
30004766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 30128283 - 30128339
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| |||||||||||||||| |||| |
|
|
| T |
30128283 |
aggctaaaatatggttttggtccctgcaaacatgtctcgttttggttttagttcctg |
30128339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 30130157 - 30130213
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
30130157 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
30130213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 31869957 - 31869901
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
31869957 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
31869901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 35177563 - 35177511
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
35177563 |
taaaatatggttttcatccttgcaaatatgcttccttttggttttaatccctg |
35177511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 39132907 - 39132851
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| | ||||||| |||||||| |
|
|
| T |
39132907 |
aggctaaaatatggttttggtccctgcaaatatgtttcatattggtttaagtccctg |
39132851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 866
Target Start/End: Original strand, 45005889 - 45005945
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
45005889 |
taaaatatggttttgatccctgcaaatatgtctcgttttgattttagtccctgcaaa |
45005945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 47114804 - 47114748
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
47114804 |
aggctaaaatatagttttggtccttgcaaatatatttcgttttagttttagttcctg |
47114748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 50196658 - 50196602
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||| ||||||| ||||||||||||| |
|
|
| T |
50196658 |
aggctaaaatatggttttagtccctacaaatatgcctcgtttttgttttagtccctg |
50196602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 808 - 855
Target Start/End: Original strand, 7956870 - 7956917
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
7956870 |
gctaaaatatggttttggtctttgtaaatatgcttcattttggtttta |
7956917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 19844265 - 19844320
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||||| |||||||||||| |
|
|
| T |
19844265 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttaattttagtccctg |
19844320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 803 - 862
Target Start/End: Complemental strand, 20644880 - 20644821
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||| | ||||||| |||||||||||| |
|
|
| T |
20644880 |
gaaaggctaaaatatggttttggtccctgtaaatataccccgttttgattttagtccctg |
20644821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 810 - 861
Target Start/End: Original strand, 20757403 - 20757454
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||| |||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
20757403 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccct |
20757454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 21159450 - 21159505
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||| ||||||||| |
|
|
| T |
21159450 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
21159505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 806 - 857
Target Start/End: Original strand, 28942524 - 28942575
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| | |||||||||||||| |
|
|
| T |
28942524 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagt |
28942575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 40169654 - 40169599
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
40169654 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
40169599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 806 - 857
Target Start/End: Original strand, 45313499 - 45313550
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
45313499 |
aggctaaaatatgattttggtccttgtaaatatgattcgttttgattttagt |
45313550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 857
Target Start/End: Complemental strand, 275833 - 275783
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||| |||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
275833 |
ggctaaaatatgattttagtccctgtaaatatgcttcgttttggttttagt |
275783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 858
Target Start/End: Complemental strand, 3361817 - 3361767
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
3361817 |
gctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
3361767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 855
Target Start/End: Original strand, 4814538 - 4814588
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
4814538 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
4814588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 7518088 - 7518142
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||| || |||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
7518088 |
aaggctaaaatatggtgttagtccctgcaaatatgcctcgtttttgttttagtcc |
7518142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 8940157 - 8940215
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||||||||||||||| || ||||||||| | ||||||||||||||||||||| |
|
|
| T |
8940157 |
aaaggttaaaatatggttttgatctctgcaaatatacctcgttttggttttagtccctg |
8940215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 14633892 - 14633834
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
14633892 |
aaaggctaaattatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
14633834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 731 - 805
Target Start/End: Complemental strand, 29020032 - 29019959
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| ||||| || || ||||| ||||| |||||||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
29020032 |
aatgtggcctttaaaaatatcttttt-taacagaatatttatataaaatcaattttgaggagaccgaaatttgaa |
29019959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 29525103 - 29525157
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||| |||||||||| |
|
|
| T |
29525103 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtcc |
29525157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 800 - 862
Target Start/End: Original strand, 35498409 - 35498471
Alignment:
| Q |
800 |
tttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||| ||| |||| | |||||||| ||||||||||||||| |||||| |
|
|
| T |
35498409 |
tttgataggctaaaatatgggtttagtccctacaaatatgattcgttttggttttaatccctg |
35498471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 38232239 - 38232293
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
38232239 |
aaggctaaaatatgattttggtccctgcaaatatgtctcgttttgattttagtcc |
38232293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 40169341 - 40169399
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
40169341 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttgattttagtccctg |
40169399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 40979713 - 40979655
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
40979713 |
aaaggctaaaatatggttttaatccctgcaaatatggctcgttttggttttaatccctg |
40979655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 51759816 - 51759874
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| | || | |||||||||| ||||||||||||||||||||| |
|
|
| T |
51759816 |
aaaggctaaaatatggttctagttcctgcaaatatgtctcgttttggttttagtccctg |
51759874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 854
Target Start/End: Original strand, 53113440 - 53113490
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
53113440 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgttttt |
53113490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 4322191 - 4322134
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
4322191 |
aaggttaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
4322134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 13514578 - 13514525
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||| ||||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
13514578 |
aggctaaaatatgattttggtacctgcaaatatgtctcgttttggttttagtcc |
13514525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 29446207 - 29446154
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| | |||||||||||||||| |
|
|
| T |
29446207 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
29446154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 807 - 860
Target Start/End: Complemental strand, 30426226 - 30426174
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
30426226 |
ggctaaaatatggttttagtcct-gcaaatatgcctcgttttgattttagtccc |
30426174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 34582522 - 34582583
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
34582522 |
aaggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctgcaaa |
34582583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 804 - 857
Target Start/End: Complemental strand, 40279338 - 40279285
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | |||||| ||||||| |
|
|
| T |
40279338 |
aaaggctaaaatatggttttggtctttgcaaatatgtcttgttttgtttttagt |
40279285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 45006247 - 45006194
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
45006247 |
ctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
45006194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 803 - 860
Target Start/End: Original strand, 47901796 - 47901853
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||| |||||||||||||| ||| || |||||||| ||||||||||||||||||| |
|
|
| T |
47901796 |
gaaaggttaaaatatggttttagtctctggaaatatgcatcgttttggttttagtccc |
47901853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 808 - 861
Target Start/End: Original strand, 50008921 - 50008974
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
50008921 |
gctagaatatggttttggtccctgcaaatatgttttattttggttttagtccct |
50008974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 863280 - 863332
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
863280 |
aggctaaaatatgattttggtccatgcaaatatgtctcgttttagttttagtc |
863332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 4321945 - 4322001
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| || ||||||||||| |||||| |
|
|
| T |
4321945 |
aggctaaaatatggttctgatccttgcaaatatgtctcattttggttttaatccctg |
4322001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 25710509 - 25710565
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
25710509 |
aggctcaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25710565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35407791 - 35407735
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| | ||||| ||||||||||||| |
|
|
| T |
35407791 |
aggctaaaatatggttttgatccctgcaaatatgtcttgtttttgttttagtccctg |
35407735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 35937121 - 35937069
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||| ||| |||||||||||||||| ||||||||||||| |
|
|
| T |
35937121 |
taaaatatggtttcggttattgaaaatatgcttcgttttagttttagtccctg |
35937069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 805 - 857
Target Start/End: Original strand, 39071860 - 39071912
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||| |||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
39071860 |
aaggctaaaatatatttttagtccttacaaatatgcttcgttttagttttagt |
39071912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 40545836 - 40545784
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
40545836 |
taaaatatgattttggtccctgcaaatatgtctcattttggttttagtccctg |
40545784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 858
Target Start/End: Original strand, 40723121 - 40723169
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||| |||||||||||||| | ||| ||||||||||||| |
|
|
| T |
40723121 |
taaaatatggttttagtccttgcaaatattcctcgatttggttttagtc |
40723169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 808 - 856
Target Start/End: Complemental strand, 51760117 - 51760069
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttag |
856 |
Q |
| |
|
|||||||||||||| | |||| ||||||||||| ||||||||||||||| |
|
|
| T |
51760117 |
gctaaaatatggttctagtccctgcaaatatgcctcgttttggttttag |
51760069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 810 - 861
Target Start/End: Original strand, 9863050 - 9863100
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||| |||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
9863050 |
taaaatatggttttagtccctgcaa-tatgcctcgttttggttttagtccct |
9863100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 20644505 - 20644560
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| || ||||| |||||||||||| |
|
|
| T |
20644505 |
ggctaaaatatagttttggtccctgcaaatatgtctcattttgattttagtccctg |
20644560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 815 - 862
Target Start/End: Original strand, 29490377 - 29490424
Alignment:
| Q |
815 |
tatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
29490377 |
tatggttttggtccctacaaatatgcaccgttttggttttagtccctg |
29490424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 858
Target Start/End: Complemental strand, 29686870 - 29686819
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||| |||||| ||| ||||||| ||| ||||||||||||||||| |
|
|
| T |
29686870 |
ggctaaaatatagttttgatccctgcaaatgtgcatcgttttggttttagtc |
29686819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 39072213 - 39072158
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| || | ||||||||||| |||||||| ||||| |||||| |
|
|
| T |
39072213 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttgattttaatccctg |
39072158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 40370285 - 40370340
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||| |||||||| |||| |
|
|
| T |
40370285 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttagttttagttcctg |
40370340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 859
Target Start/End: Original strand, 46186410 - 46186461
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
46186410 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtcc |
46186461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 806 - 857
Target Start/End: Original strand, 46901103 - 46901154
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
46901103 |
aggctaaaatatggttttagtctctgcaaatatgtatcgttttggttttagt |
46901154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 47902145 - 47902090
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
47902145 |
ggctaaaatatagttttagtccccgcaaatatgcattgttttggttttagtccctg |
47902090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 858
Target Start/End: Complemental strand, 50261936 - 50261885
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||| ||| |||||||||||||| |
|
|
| T |
50261936 |
ggctaaaatatcgttttagtccctgcaaatatgtttcattttggttttagtc |
50261885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 858
Target Start/End: Complemental strand, 11463480 - 11463430
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||| |||| |||||| |||| ||||||||||||||||| |
|
|
| T |
11463480 |
gctaaaatatggtttcggtcgctgcaaaaatgcctcgttttggttttagtc |
11463430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 29678387 - 29678333
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
29678387 |
ggctaaaatatgattttggtccctgcaaatatgccctgttttggttttagcccct |
29678333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 30130506 - 30130452
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||| || ||||||||||||||| |
|
|
| T |
30130506 |
aaggctcaaatatggttttagtcactgcaaatatgcctcattttggttttagtcc |
30130452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 809 - 859
Target Start/End: Complemental strand, 43440785 - 43440735
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||| |||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43440785 |
ctaaaatataattttagtccctgcaaatatgcctcgttttggttttagtcc |
43440735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 46724901 - 46724847
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| || |||||||||| || |||||| |||||||||||| |
|
|
| T |
46724901 |
gctaaaatatggttttgatctctgcaaatatgttttgttttgattttagtccctg |
46724847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 14772523 - 14772470
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| || | ||||||||| | || |||||||||||||||||| |
|
|
| T |
14772523 |
ctaaaatatggttttagtacatgcaaatatacctcattttggttttagtccctg |
14772470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 858
Target Start/End: Complemental strand, 19297947 - 19297898
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
19297947 |
ctaaaatatagttttggtccttgtaaatatgtctcgttttgtttttagtc |
19297898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 804 - 849
Target Start/End: Original strand, 25353196 - 25353241
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttg |
849 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
25353196 |
aaaggctagaatatggttttagtccctgcaaatatgcctcgttttg |
25353241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 817 - 862
Target Start/End: Complemental strand, 25610061 - 25610016
Alignment:
| Q |
817 |
tggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
25610061 |
tggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
25610016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 31869596 - 31869649
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| | | |||||||||| ||||||||||||||||||||| |
|
|
| T |
31869596 |
ctaaaatatggttttaattcctgcaaatatgtctcgttttggttttagtccctg |
31869649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 808 - 857
Target Start/End: Complemental strand, 36673244 - 36673195
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
36673244 |
gctaaaatatggttttggtccctgcaaatatgacttattttggttttagt |
36673195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 46724545 - 46724598
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
46724545 |
ctaaaatatgattttgatccttgcaaatatatctcgttttagttttagtccctg |
46724598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 752 - 796
Target Start/End: Original strand, 52032797 - 52032842
Alignment:
| Q |
752 |
tttttctaacataatatttaaataaaa-tcaattttgtggagacca |
796 |
Q |
| |
|
||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
52032797 |
tttttttaacaaaatatttaaataaaaatcaattttgtggagacca |
52032842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 816 - 857
Target Start/End: Complemental strand, 52956691 - 52956650
Alignment:
| Q |
816 |
atggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
52956691 |
atggttttggtctctgcaaatatgcatcgttttggttttagt |
52956650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 73; Significance: 8e-33; HSPs: 210)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 8e-33
Query Start/End: Original strand, 106 - 190
Target Start/End: Complemental strand, 5088558 - 5088474
Alignment:
| Q |
106 |
ataaaaatctgtaactacgcgtgggagagggaaatagtgaagctttggcacgtgtattccactttcgtcaaaattcgcaccggaa |
190 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5088558 |
ataaaaatctgtaactacacgtgggagagggaaatagttaagctttgccacgtgtattccactttcgtcaaaattcgcaccggaa |
5088474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 45638580 - 45638639
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45638580 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
45638639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 799 - 866
Target Start/End: Complemental strand, 47819604 - 47819537
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47819604 |
attttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
47819537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 38164298 - 38164236
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38164298 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
38164236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 10887232 - 10887292
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10887232 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctgcaaa |
10887292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 47819231 - 47819291
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47819231 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
47819291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 24653802 - 24653861
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24653802 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
24653861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 10631531 - 10631469
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10631531 |
aaaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaa |
10631469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 24507846 - 24507788
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
24507846 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24507788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 30322926 - 30322988
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30322926 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
30322988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 33000672 - 33000610
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33000672 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
33000610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 33045693 - 33045635
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
33045693 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
33045635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 8140801 - 8140740
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8140801 |
aaggctaaaatatggttttggtacctgcaaatatgcctcgttttggttttagtccctgcaaa |
8140740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 15526364 - 15526303
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15526364 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
15526303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 808 - 865
Target Start/End: Original strand, 32420099 - 32420156
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32420099 |
gctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctgcaa |
32420156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 38163929 - 38163990
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38163929 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
38163990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 3247559 - 3247503
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3247559 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
3247503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 15516581 - 15516641
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
15516581 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccctgcaaa |
15516641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 30323294 - 30323234
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30323294 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
30323234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 35056895 - 35056835
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35056895 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
35056835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 45380271 - 45380331
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45380271 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
45380331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 806 - 865
Target Start/End: Complemental strand, 16026939 - 16026880
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||||||||||||||||||| |
|
|
| T |
16026939 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaa |
16026880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 24507479 - 24507538
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24507479 |
ggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaa |
24507538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 803 - 866
Target Start/End: Complemental strand, 24654171 - 24654108
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
24654171 |
gaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctgcaaa |
24654108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 24977778 - 24977837
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24977778 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
24977837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 35056530 - 35056589
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35056530 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
35056589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 37545628 - 37545687
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37545628 |
ggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctgcaaa |
37545687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 38136981 - 38136922
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38136981 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
38136922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 38151212 - 38151157
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38151212 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38151157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 40718110 - 40718169
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40718110 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
40718169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 45380636 - 45380577
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
45380636 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
45380577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 809 - 860
Target Start/End: Original strand, 46183686 - 46183737
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46183686 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccc |
46183737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 1810924 - 1810982
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1810924 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1810982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 731 - 805
Target Start/End: Complemental strand, 3167550 - 3167476
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||| | ||||| || |||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3167550 |
aatgtgccctttaaaaatatatttttttaacaaaatatttatataaaatcaattttgtggagaccaaaatttgaa |
3167476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 3247195 - 3247253
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3247195 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
3247253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 807 - 865
Target Start/End: Complemental strand, 15211858 - 15211800
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||| |
|
|
| T |
15211858 |
ggctaaaatatggttttggtccttgcaaatatgcctcgttttggtttcaatccctgcaa |
15211800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 18079395 - 18079453
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
18079395 |
aaaggctaaaatacggttttggtccttgcaaatatgcctcattttggttttagtccctg |
18079453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 19720709 - 19720767
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19720709 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19720767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 26207275 - 26207333
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26207275 |
aaagactaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
26207333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 33234543 - 33234601
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
33234543 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
33234601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 38150845 - 38150907
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38150845 |
aaaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
38150907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 44157696 - 44157750
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44157696 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
44157750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 45368487 - 45368545
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45368487 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45368545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 49073688 - 49073750
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
49073688 |
aaaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttaatccctacaaa |
49073750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 12360970 - 12360913
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
12360970 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
12360913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 26061954 - 26062011
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26061954 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26062011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 26442901 - 26442844
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26442901 |
aaggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccctg |
26442844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 29072495 - 29072552
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29072495 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29072552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 32729051 - 32728994
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32729051 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
32728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 804 - 861
Target Start/End: Original strand, 33379885 - 33379942
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
33379885 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
33379942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 990380 - 990324
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
990380 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
990324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 8140433 - 8140489
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8140433 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8140489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 803 - 859
Target Start/End: Original strand, 11822000 - 11822056
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
11822000 |
gaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
11822056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 13260322 - 13260262
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13260322 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
13260262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 13770488 - 13770544
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13770488 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13770544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 18302388 - 18302332
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
18302388 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18302332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 18473271 - 18473327
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
18473271 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18473327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 18473597 - 18473541
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
18473597 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18473541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 19721071 - 19721015
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19721071 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
19721015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 22919683 - 22919739
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
22919683 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22919739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 24649661 - 24649605
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24649661 |
aggccaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
24649605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 26191359 - 26191411
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
26191359 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
26191411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 26324584 - 26324640
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26324584 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
26324640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 35005745 - 35005685
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
35005745 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccttgcaaa |
35005685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 39747836 - 39747780
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
39747836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
39747780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 41358368 - 41358424
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41358368 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41358424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 799 - 862
Target Start/End: Complemental strand, 3753580 - 3753517
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
3753580 |
attttaaaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
3753517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 7001897 - 7001842
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7001897 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7001842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 10631164 - 10631219
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
10631164 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10631219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 10887599 - 10887544
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
10887599 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
10887544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 12158690 - 12158749
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12158690 |
ggctaaaatatggttttagtctctgcaaatatgcatcgttttggttttagtccctgcaaa |
12158749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 16060885 - 16060830
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
16060885 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16060830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 31060787 - 31060846
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
31060787 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctgcaaa |
31060846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 33000305 - 33000360
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
33000305 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
33000360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 35308111 - 35308056
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35308111 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35308056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 40718474 - 40718415
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
40718474 |
ggctaaaatatggttttggtccctgcaaatatgcatagttttgattttagtccctgcaaa |
40718415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 3679623 - 3679681
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
3679623 |
aaaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
3679681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 3753214 - 3753268
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3753214 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3753268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 24978125 - 24978067
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
24978125 |
aaaggctaaaatatagttttggtcctggcaaatatgcctcgttttggttttagttcctg |
24978067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 35005441 - 35005499
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
35005441 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35005499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 45290454 - 45290512
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
45290454 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
45290512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 809 - 859
Target Start/End: Complemental strand, 48730615 - 48730565
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
48730615 |
ctaaaatatggttttggtccttgcaaatatgcctcgtttttgttttagtcc |
48730565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 990086 - 990143
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
990086 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
990143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 4789310 - 4789363
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4789310 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4789363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 6567498 - 6567441
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
6567498 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
6567441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 12361009 - 12361066
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
12361009 |
aaggctaaaatatggttttagtccctgcaaatttgcctcgttttggttttagtccctg |
12361066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 801 - 858
Target Start/End: Original strand, 15211505 - 15211562
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
15211505 |
ttgaaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtc |
15211562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 800 - 861
Target Start/End: Original strand, 16026566 - 16026627
Alignment:
| Q |
800 |
tttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
16026566 |
tttgaaaggctaaaatataattttggtccctgcaaatatccctcgttttggttttagtccct |
16026627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 19623019 - 19622962
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19623019 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
19622962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 31061153 - 31061092
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31061153 |
aaggctaaaatatggttttgatccctgcaaatatatctcgttttggttttagtccctgcaaa |
31061092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 31258337 - 31258394
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
31258337 |
aaggctaaaatatggttttagtccctgtaaatatgcctcgttttggttttagtccctg |
31258394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 35307713 - 35307770
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
35307713 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
35307770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 39747472 - 39747532
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
39747472 |
aaggctaaaatatggttttggtcc-tgcaaatacgtctcgttttggttttagtccctgcaaa |
39747532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 854
Target Start/End: Complemental strand, 42483273 - 42483224
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
42483273 |
aaggctaaaatatggttttggtccctgcaaatatgctttgttttggtttt |
42483224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 804 - 861
Target Start/End: Complemental strand, 44158045 - 44157988
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
44158045 |
aaaggctaaaatatggtttttgtccctgcaaatatgcctagttttggttttagtccct |
44157988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 808 - 861
Target Start/End: Original strand, 44641079 - 44641132
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
44641079 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
44641132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 7867128 - 7867184
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
7867128 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
7867184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 14007488 - 14007544
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14007488 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14007544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 21391095 - 21391151
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
21391095 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
21391151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 26699607 - 26699556
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
26699607 |
aggctaaaatatggttttggtcct-gcaaatatgcttcgtttttgttttagtc |
26699556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 29688430 - 29688374
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
29688430 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccct |
29688374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 32454295 - 32454239
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32454295 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggctttagtccctg |
32454239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 33045354 - 33045410
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
33045354 |
aggctaaaatttggttttggtccctgcaaatatgcctagttttggttttagtccctg |
33045410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 45290821 - 45290765
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
45290821 |
aggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
45290765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 854
Target Start/End: Complemental strand, 49074054 - 49074006
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
49074054 |
aggctaaaatatggttttggtccttgtaaatatgcttcgttttgatttt |
49074006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 49923819 - 49923763
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
49923819 |
aggctaaaatatgattttggtctctgcaaatatgcttcgttttgattttagtccctg |
49923763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 50429210 - 50429154
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
50429210 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
50429154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 50799129 - 50799185
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
50799129 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 12322970 - 12322915
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
12322970 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctg |
12322915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 808 - 859
Target Start/End: Original strand, 15058419 - 15058470
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
15058419 |
gctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtcc |
15058470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 19622654 - 19622709
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
19622654 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
19622709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 24649350 - 24649405
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24649350 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagcccctg |
24649405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 29072862 - 29072807
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
29072862 |
ggctaaaatatggttttagtccctgcaaatatgcctcgctttggttttagtccctg |
29072807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 33234912 - 33234857
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
33234912 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttgattttagtccctg |
33234857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 41738796 - 41738851
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||| ||||||||||||| |
|
|
| T |
41738796 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagtccctg |
41738851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 44641432 - 44641377
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44641432 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
44641377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 48956066 - 48956011
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
48956066 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
48956011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 52254180 - 52254235
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
52254180 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
52254235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 52254479 - 52254424
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
52254479 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
52254424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 5058995 - 5058937
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||||||||||||||||||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
5058995 |
aaaggttaaaatatggttttggtccctggaaatatgcctcgttttgattttagtccctg |
5058937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 16060593 - 16060646
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| ||||||||||||||||| |
|
|
| T |
16060593 |
aaaggctaaaatatggttttggtccct-caaatatgcctcgttttggttttagtc |
16060646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 731 - 805
Target Start/End: Original strand, 21485857 - 21485931
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| ||||| || |||| ||| ||||| |||||||| |||||||||||||| |||||||||||| ||||| |
|
|
| T |
21485857 |
aatgtggcctttaaaaatatatatttttaacagaatatttatataaaatcaattttatggagaccaaaacttgaa |
21485931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 807 - 857
Target Start/End: Complemental strand, 24510308 - 24510258
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
24510308 |
ggctaaaatatggttttggtccctgcaaatatggttcgttttagttttagt |
24510258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 32626526 - 32626584
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
32626526 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
32626584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 34002943 - 34002885
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
34002943 |
aaaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
34002885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 39025381 - 39025328
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
39025381 |
ggctaaaatatggttttggtccctgcaaa-atgcctcgttttggttttagtccct |
39025328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 48609233 - 48609291
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
48609233 |
aaaggctaaaatatggttttagtcccggcaaatatgtctcgttttggttttagtccctg |
48609291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 7867359 - 7867302
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
7867359 |
aaggctaaaatatggttttggtccctgcaaatatgtcttattttggttttagtccctg |
7867302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 8364614 - 8364667
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
8364614 |
aaggttaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
8364667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 17129691 - 17129744
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| | | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17129691 |
ctaaaatatggttttgattcctgcaaatatgcctcgttttggttttagtccctg |
17129744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 17984331 - 17984384
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17984331 |
aaggctaaaatatggtttgagtccctgcaaatatgcctcgttttggttttagtc |
17984384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 33067347 - 33067400
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||| |||| |
|
|
| T |
33067347 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttggtcc |
33067400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 41881091 - 41881148
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
41881091 |
aaggctaaaatatggttttagtccctccaaatatgtctcgttttggttttagtccctg |
41881148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 855
Target Start/End: Complemental strand, 45638895 - 45638846
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
45638895 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
45638846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 11822366 - 11822310
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
11822366 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctg |
11822310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 12322604 - 12322656
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
12322604 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttgattttagtcc |
12322656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 12360602 - 12360658
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||| ||||||| ||||| |
|
|
| T |
12360602 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttagttttagcccctg |
12360658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 13259987 - 13260043
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13259987 |
aggctaaaatatggttttagtcgctgcaaatatggctcgttttggttttagtccctg |
13260043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 18900130 - 18900078
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
18900130 |
taaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
18900078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 22674202 - 22674254
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
22674202 |
aggctaaaatatggtttaggtccatgcaaatatgtctcgttttggttttagtc |
22674254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 26191734 - 26191682
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
26191734 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26191682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 26324948 - 26324896
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
26324948 |
aggctaaaatatgattttagtccatgcaaatatgcctcgttttggttttagtc |
26324896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 26442563 - 26442615
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
26442563 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
26442615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 31258699 - 31258647
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
31258699 |
taaaatatggttttagtccctgcaaatatgcctcgtttttgttttagtccctg |
31258647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 41358664 - 41358608
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
41358664 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
41358608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 42482978 - 42483030
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
42482978 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtc |
42483030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 48609595 - 48609543
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
48609595 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
48609543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 48955713 - 48955765
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
48955713 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
48955765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 50428872 - 50428928
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||| |||||| |
|
|
| T |
50428872 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttgcttttaatccctg |
50428928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 3679986 - 3679931
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
3679986 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
3679931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 731 - 805
Target Start/End: Complemental strand, 4941862 - 4941787
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttct-aacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||||||||| || |||||||| | |||| |||| ||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
4941862 |
aatgtggcttttaaaaatatatttttttcaacagaatagttatataaaatcaattgtgtggagactaaaatttgaa |
4941787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 15466132 - 15466187
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| || |||||||||||||||||| |
|
|
| T |
15466132 |
ggctaaaatatggttttggtccttacggatatgcctcattttggttttagtccctg |
15466187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 855
Target Start/End: Complemental strand, 17130086 - 17130035
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
17130086 |
aaagactaaaatatggttttggtccctgcaaatatgtctcgttttggtttta |
17130035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 858
Target Start/End: Complemental strand, 17984701 - 17984650
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
17984701 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
17984650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 20948755 - 20948810
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||| |||||||||||||| |
|
|
| T |
20948755 |
ggctaaaatatggttttggtccctacaaatatgtctcgtttgggttttagtccctg |
20948810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 25658014 - 25658069
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |||||| |
|
|
| T |
25658014 |
ggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttaatccctg |
25658069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 46868577 - 46868522
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46868577 |
ggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
46868522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 812 - 862
Target Start/End: Original strand, 2939934 - 2939984
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2939934 |
aaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
2939984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 858
Target Start/End: Original strand, 4323829 - 4323879
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||| |||||||| |
|
|
| T |
4323829 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
4323879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 27521577 - 27521631
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
27521577 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
27521631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 30968144 - 30968082
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
30968144 |
aaaggctaaaatatgacattggtccctgcaaatatgctcaattttggttttagtccctgcaaa |
30968082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 37624744 - 37624798
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| | |||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
37624744 |
aaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttggtcc |
37624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 39303675 - 39303729
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||| ||||||||||||||||||||| |
|
|
| T |
39303675 |
gctaaaatatggttttagtccctgcaagtatgtctcgttttggttttagtccctg |
39303729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 41739121 - 41739068
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
41739121 |
aggctaaaatatggttttagtccctgcaaata---ttcgttttggttttagtccctg |
41739068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 46868223 - 46868277
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||| |||| |||| |||| |||||||||||||| |||||||||||||| |
|
|
| T |
46868223 |
aaaggctaaattatgattttagtccctgcaaatatgcttcattttggttttagtc |
46868277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 9 - 49
Target Start/End: Complemental strand, 5088653 - 5088612
Alignment:
| Q |
9 |
ttattcaccggtgaa-aaaacgaagcaaacttgagagatgac |
49 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5088653 |
ttattcaccggtgaataaaacgaagcaaacttgagagatgac |
5088612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 810 - 859
Target Start/End: Complemental strand, 7350733 - 7350684
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
7350733 |
taaaatatggttttggtcactgcaaatatacctcgttttggttttagtcc |
7350684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 808 - 857
Target Start/End: Original strand, 7818783 - 7818832
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
7818783 |
gctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagt |
7818832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 804 - 857
Target Start/End: Complemental strand, 15058769 - 15058716
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||| |||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
15058769 |
aaaggctaaaatattgttttgatccctgcaaatatgtctcgttttggttttagt |
15058716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 804 - 849
Target Start/End: Complemental strand, 18079663 - 18079618
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttg |
849 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||| |
|
|
| T |
18079663 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttg |
18079618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 18899837 - 18899894
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
18899837 |
aaggttaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18899894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 22919978 - 22919925
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
22919978 |
aggctaaaatatggttttagtctctgcaaatatgcctcgttttagttttagtcc |
22919925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 807 - 856
Target Start/End: Complemental strand, 22953556 - 22953507
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttag |
856 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||| |
|
|
| T |
22953556 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttag |
22953507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 29579322 - 29579375
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || |||| |||||||||||| |
|
|
| T |
29579322 |
ctaaaatatggtttttgtccttgcaaatatgcctcattttaattttagtccctg |
29579375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 45368847 - 45368794
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45368847 |
ctaaaatatgattttagtctctgcaaatatgcctcgttttggttttagtccctg |
45368794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 764 - 805
Target Start/End: Complemental strand, 46150083 - 46150042
Alignment:
| Q |
764 |
aatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
46150083 |
aatatttatagaaaatcaattttgtggagaccaaaatttgaa |
46150042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 4565337 - 4565281
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
4565337 |
aggctaaaatatggttctggtccctgcaaatatgtctcgttttaattttagtccctg |
4565281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 858
Target Start/End: Original strand, 4617091 - 4617139
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||| ||||||||| |
|
|
| T |
4617091 |
taaaatatggttttggtccctgaaaatatgtttcgttttagttttagtc |
4617139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 7819104 - 7819052
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
7819104 |
aggctaaaatatggttttaatctctgcaaatatgcctcgttttggttttagtc |
7819052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 8364917 - 8364861
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| ||||||||||||| ||||||| |
|
|
| T |
8364917 |
aggctaaaatatagttttggtccccgcaaatatgtctcgttttggttttcgtccctg |
8364861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 15335292 - 15335240
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
15335292 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagttcctg |
15335240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 21383103 - 21383159
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
21383103 |
aggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
21383159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 21383429 - 21383373
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||| || ||||| |||||||||||| |
|
|
| T |
21383429 |
aggctaaaatatagttttaatccttgcaaatatgcctcattttgattttagtccctg |
21383373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 28507459 - 28507403
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| || |||| ||||||||||||| |
|
|
| T |
28507459 |
aggctaaaatattgttttggtccctgcaaatatgtctcattttagttttagtccctg |
28507403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 32906237 - 32906189
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
32906237 |
taaaatatgattttggtccttgcaaatatgtctcgttttgattttagtc |
32906189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 34808200 - 34808252
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
34808200 |
taaaatatggttttagtcccttcaaatatgtctcgttttggttttagtccctg |
34808252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 799 - 861
Target Start/End: Original strand, 292853 - 292913
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||| |||||||||||| |||||| |||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
292853 |
atttaaaaggctaaaat--ggttttagtccctgcaaatatgcctcgttttgcttttagtccct |
292913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 1159839 - 1159784
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| || ||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
1159839 |
ggctaaaatatgattttagttcttgcaaatgtgccttgttttggttttagtccctg |
1159784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 806 - 865
Target Start/End: Original strand, 30962415 - 30962474
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
30962415 |
aggctaaaatatggcattggtccctgcaaatatgtccagttttggttttagtccctgcaa |
30962474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 855
Target Start/End: Complemental strand, 33067729 - 33067682
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33067729 |
gctaaaatatcgttttagtccttgcaaatatgtctcgttttggtttta |
33067682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 750 - 805
Target Start/End: Original strand, 34771266 - 34771321
Alignment:
| Q |
750 |
tatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||| |||||||||||||| |||||| |||||||||| | | ||||||||||| |
|
|
| T |
34771266 |
tatttttataacataatatttatataaaaccaattttgtgcataacaaaatttgaa |
34771321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 806 - 849
Target Start/End: Original strand, 36912852 - 36912895
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttg |
849 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
36912852 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttg |
36912895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 812 - 862
Target Start/End: Complemental strand, 4789639 - 4789589
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||| ||||||||||| || |||||||||| ||||||| |
|
|
| T |
4789639 |
aaatttggttttggtccctgcaaatatgcatcattttggttttggtccctg |
4789589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 5058736 - 5058789
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| || ||||| ||||||||||||| |
|
|
| T |
5058736 |
gctaaaatatgattttggtccatgcaaatatg-ttagttttagttttagtccctg |
5058789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 7350421 - 7350475
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| || ||||||||||||||| |
|
|
| T |
7350421 |
aaggttaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
7350475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 731 - 805
Target Start/End: Original strand, 13269238 - 13269312
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||||||| | ||| |||||| ||| |||||||| |||||||||||| ||||||||| |||||||||| |
|
|
| T |
13269238 |
aatgtggctttttaaaaataatttttttaattgaatatttatataaaatcaattgtgtggagacaaaaatttgaa |
13269312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 15211783 - 15211741
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
15211783 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
15211741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 17130011 - 17129969
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
17130011 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
17129969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 19198948 - 19198894
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| || ||||||||||| || ||||| |||||||||||| |
|
|
| T |
19198948 |
gctaaaatatggttttgatctctgcaaatatgcctcattttgcttttagtccctg |
19198894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 858
Target Start/End: Complemental strand, 21391377 - 21391323
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||| |||||||||||||| |||| || |||||||| ||||||| ||||||||| |
|
|
| T |
21391377 |
aaaggttaaaatatggttttagtccctgtaaatatgcctcgttttagttttagtc |
21391323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 25658304 - 25658246
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||| ||||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
25658304 |
aaagactaaaatattcttttgatccctgcaaatatgcctcgttttgattttagtccctg |
25658246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 854
Target Start/End: Original strand, 31404490 - 31404524
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
31404490 |
ttttggtccttgcaaatatgcttcgttttgatttt |
31404524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 854
Target Start/End: Original strand, 34002632 - 34002682
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
|||||||||| |||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
34002632 |
aaaggctaaagtatgattttggtccctgcaaatatgtctcgttttggtttt |
34002682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 37646739 - 37646797
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||| |||||| | || |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
37646739 |
aaaggcttaaatattgcattcgtccctgcaaatatgcttcgttttgattttagtccctg |
37646797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 39025107 - 39025161
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| |||||||| |||| |||| |
|
|
| T |
39025107 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttgattttcgtcc |
39025161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 731 - 805
Target Start/End: Complemental strand, 40778141 - 40778067
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| ||||| || || ||| | ||||| |||||||| ||||| |||||||||| || ||||||||||||| |
|
|
| T |
40778141 |
aatgtggcctttaaaaatatttttatttaacaaaatatttatataaagtcaattttgtagataccaaaatttgaa |
40778067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 49073980 - 49073938
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
49073980 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
49073938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 4360628 - 4360571
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||| |||||||| ||||| |
|
|
| T |
4360628 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttggggttttagcccctg |
4360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 16083045 - 16083098
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| ||||||| ||||||||| |
|
|
| T |
16083045 |
aaggctaaaatatggttttagtccccgcaaatatgtctcgtttttgttttagtc |
16083098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 839
Target Start/End: Complemental strand, 32035789 - 32035756
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatg |
839 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
32035789 |
aggctaaaatatggttttggtccctgcaaatatg |
32035756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 2e-24; HSPs: 167)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 5233805 - 5233867
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233805 |
aaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
5233867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 804 - 865
Target Start/End: Complemental strand, 25988752 - 25988691
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25988752 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaa |
25988691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 8144659 - 8144599
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8144659 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
8144599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 23399611 - 23399671
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23399611 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
23399671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 23676453 - 23676393
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23676453 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
23676393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 26878072 - 26878012
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26878072 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
26878012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 29198663 - 29198603
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29198663 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
29198603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 48192489 - 48192429
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48192489 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
48192429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 799 - 862
Target Start/End: Complemental strand, 9659697 - 9659634
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9659697 |
attttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
9659634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 803 - 866
Target Start/End: Original strand, 48192253 - 48192316
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48192253 |
gaaaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
48192316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 1614907 - 1614849
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1614907 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1614849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 3975546 - 3975604
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3975546 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3975604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 8144292 - 8144354
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8144292 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
8144354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 23399979 - 23399917
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23399979 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
23399917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 25092157 - 25092219
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25092157 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
25092219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 25092551 - 25092489
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
25092551 |
aaaggctaaaatatggttttggtccctgcaaatatgcctctttttggttttagtccctgcaaa |
25092489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 801 - 862
Target Start/End: Complemental strand, 12894408 - 12894347
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12894408 |
ttgaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
12894347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 45228920 - 45228863
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45228920 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
45228863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 1614558 - 1614618
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1614558 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
1614618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 11767276 - 11767220
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
11767276 |
aggctaaaatatggttttggtccctgcaaatatgcttcattttggttttagtccctg |
11767220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 25988384 - 25988444
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25988384 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
25988444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 10358368 - 10358313
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10358368 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
10358313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 16853589 - 16853534
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16853589 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16853534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 27037593 - 27037652
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
27037593 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaa |
27037652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 800 - 859
Target Start/End: Original strand, 48852437 - 48852496
Alignment:
| Q |
800 |
tttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
48852437 |
tttgaaaggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtcc |
48852496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 6108331 - 6108389
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
6108331 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
6108389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 14739007 - 14738949
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
14739007 |
aaaggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
14738949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 19757745 - 19757803
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19757745 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19757803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 27458396 - 27458454
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27458396 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27458454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 30223458 - 30223520
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30223458 |
aaaggctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctgcaaa |
30223520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 30223797 - 30223743
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
30223797 |
aaggctaaaatatggttttggtccatgcaaatatgcctcgttttggttttagtcc |
30223743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 39439032 - 39438970
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
39439032 |
aaaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaa |
39438970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 44509057 - 44508999
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44509057 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 44568693 - 44568631
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44568693 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaa |
44568631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 3975839 - 3975786
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3975839 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
3975786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 809 - 858
Target Start/End: Complemental strand, 6847117 - 6847068
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6847117 |
ctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtc |
6847068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 28911908 - 28911851
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28911908 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28911851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 44568324 - 44568385
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44568324 |
aaggctaaaatatggttttggtccctgcaaatataactcgttttggttttagtccctgcaaa |
44568385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 5354767 - 5354823
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
5354767 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtccctg |
5354823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 17999722 - 17999666
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
17999722 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
17999666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 866
Target Start/End: Original strand, 23676135 - 23676191
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23676135 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
23676191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 29198302 - 29198362
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29198302 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctgcaaa |
29198362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35104296 - 35104240
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35104296 |
aggctcaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
35104240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35838338 - 35838282
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35838338 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35838282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 41054237 - 41054181
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
41054237 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 1006835 - 1006890
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1006835 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
1006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 1974009 - 1974064
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
1974009 |
ggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
1974064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 44508720 - 44508775
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44508720 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44508775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 2945848 - 2945790
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
2945848 |
aaaggctaaaatatgtttttggtccctacaaatatgcctcgttttggttttagtccctg |
2945790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 5234207 - 5234149
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
5234207 |
aaaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
5234149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 6509205 - 6509263
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
6509205 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttcgttttagtccctg |
6509263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 8555802 - 8555744
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
8555802 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
8555744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 16940759 - 16940817
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
16940759 |
aaaggctaacatatggttttggtccctgcaaatatgcctcggtttggttttagtccctg |
16940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 35837922 - 35837976
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35837922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
35837976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 37372907 - 37372849
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
37372907 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtacctg |
37372849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 39520395 - 39520453
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
39520395 |
aaaggctaaaatatggttttggtccatccaaatatgtctcgttttggttttagtccctg |
39520453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 44344792 - 44344734
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44344792 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
44344734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 44403249 - 44403195
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44403249 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccct |
44403195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 48854073 - 48854015
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
48854073 |
aaaggctaaaatatgattttgatccctgcaaatatgtttcgttttggttttagtccctg |
48854015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 6509472 - 6509415
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
6509472 |
aaggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
6509415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 752 - 805
Target Start/End: Original strand, 24504358 - 24504411
Alignment:
| Q |
752 |
tttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24504358 |
tttttttaacaaaatatttatataaaatcaattttgtggagaccaaaatttgaa |
24504411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 26877676 - 26877737
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26877676 |
aaggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccctgcaaa |
26877737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 39520732 - 39520675
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
39520732 |
aaggttaaaatatggttttggtccttgcaaatatgtctcgttttgattttagtccctg |
39520675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 41053840 - 41053897
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || ||||| |||||||||||| |
|
|
| T |
41053840 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttgattttagtccctg |
41053897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 45073643 - 45073586
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
45073643 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
45073586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 46759657 - 46759710
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
46759657 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
46759710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 46828942 - 46828999
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
46828942 |
aaggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
46828999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 6589021 - 6589073
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
6589021 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtcc |
6589073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 9659354 - 9659414
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
9659354 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaa |
9659414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 12932784 - 12932728
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
12932784 |
aggctaaaatatgtttttggtccctgcaaatatgcctcgttttgattttagtccctg |
12932728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 16941049 - 16940997
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
16941049 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctg |
16940997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 20388273 - 20388329
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
20388273 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20388329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 21223750 - 21223694
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
21223750 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
21223694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 28262712 - 28262768
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || ||||||||||| |||||| |
|
|
| T |
28262712 |
aggctaaaatatggttttggtccctgcaaatatgcctcattttggttttaatccctg |
28262768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 28911576 - 28911632
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
28911576 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
28911632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35015221 - 35015165
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
35015221 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
35015165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 39438740 - 39438792
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
39438740 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
39438792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 39832905 - 39832961
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
39832905 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
39832961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 45228614 - 45228674
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
45228614 |
aggctaaaatatggttttgggccccgcaaatatgcctcgtttttgttttagtccctgcaaa |
45228674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 5308323 - 5308378
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
5308323 |
ggctaaaatatggttttagtccttgcaaatatgtctcgttttagttttagtccctg |
5308378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 6589277 - 6589222
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||| | |||||||||||||||| |
|
|
| T |
6589277 |
aaaggttaaaatatggttttggtccctgcaaatatgccttgttttggttttagtcc |
6589222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 858
Target Start/End: Original strand, 7431951 - 7432002
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
7431951 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
7432002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 750 - 805
Target Start/End: Original strand, 7738779 - 7738834
Alignment:
| Q |
750 |
tatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
7738779 |
tatttttttaacaaaatatttatataaaatcaattttgtggaaaccaaaatttgaa |
7738834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 810 - 861
Target Start/End: Original strand, 11766920 - 11766971
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||| |||||| |
|
|
| T |
11766920 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttcgtccct |
11766971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 14543707 - 14543762
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
14543707 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
14543762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 17999465 - 17999520
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
17999465 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttcgtccctg |
17999520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 19561450 - 19561395
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19561450 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19561395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 858
Target Start/End: Original strand, 21223405 - 21223456
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
21223405 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtc |
21223456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 35210515 - 35210460
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35210515 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
35210460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 858
Target Start/End: Original strand, 35469880 - 35469931
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
35469880 |
ggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtc |
35469931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 39833236 - 39833181
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| || | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39833236 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
39833181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 799 - 862
Target Start/End: Complemental strand, 44958514 - 44958451
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
44958514 |
atttcaaaggctaaaatatgattttggtccctacaaatatgtctcgttttggttttagtccctg |
44958451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 46304384 - 46304329
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
46304384 |
ggctaaaatatagttttagtccctgcaaatatgtttcgttttggttttagtccctg |
46304329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 46759942 - 46759887
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46759942 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctg |
46759887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 816 - 862
Target Start/End: Complemental strand, 1271590 - 1271544
Alignment:
| Q |
816 |
atggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1271590 |
atggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1271544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 1559708 - 1559650
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
1559708 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttaattttagtccctg |
1559650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 6079810 - 6079864
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
6079810 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
6079864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 807 - 857
Target Start/End: Original strand, 19561154 - 19561204
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
19561154 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
19561204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 30352557 - 30352615
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||| |||||||||||| |||||||| |
|
|
| T |
30352557 |
aaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggtttcagtccctg |
30352615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 35104075 - 35104133
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35104075 |
aaaggctaaaatataattttggtccctgcaaatatgtctcgttttggttttagtccctg |
35104133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 13770083 - 13770026
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
13770083 |
aaggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagttcctg |
13770026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 18022705 - 18022652
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18022705 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
18022652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 32189388 - 32189335
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32189388 |
ctaaaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
32189335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 38186364 - 38186421
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| |||||||| |||||| ||||| |
|
|
| T |
38186364 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttgattttaggccctg |
38186421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 44402958 - 44403015
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
44402958 |
aaggctaaaatatggttttagtccctgcaaatatgccccattttggttttagtccctg |
44403015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 807 - 863
Target Start/End: Original strand, 45021494 - 45021551
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgtttt-ggttttagtccctgc |
863 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
45021494 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgggttttagtccctgc |
45021551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 5355114 - 5355066
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||| |||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
5355114 |
taaagtatggttttggtccctgcaaatatgcctcgttttggttttagtc |
5355066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 10358000 - 10358056
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| | || |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10358000 |
aggctaaaatatgatcttagtccctgcaaatatgcctcgttttggttttagtccctg |
10358056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 13769774 - 13769826
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
13769774 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
13769826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 21554754 - 21554698
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| | |||||| |||||||||||| |
|
|
| T |
21554754 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttgattttagtccctg |
21554698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 23816669 - 23816721
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
23816669 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
23816721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 30709645 - 30709585
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
30709645 |
aggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtctctgcaaa |
30709585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 805 - 853
Target Start/End: Complemental strand, 31310681 - 31310633
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttt |
853 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||| |
|
|
| T |
31310681 |
aaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttt |
31310633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 804 - 856
Target Start/End: Complemental strand, 31732454 - 31732402
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttag |
856 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||| |||||| |
|
|
| T |
31732454 |
aaaggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttag |
31732402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 855
Target Start/End: Original strand, 32189076 - 32189124
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||||||||||||||||||| |
|
|
| T |
32189076 |
ggctaaaatatgattttagtccctgcaaatatgcttcgttttggtttta |
32189124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35470281 - 35470225
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
35470281 |
aggctaaaatttggttttgatccctgcaaatatgcctcattttggttttagtccctg |
35470225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 35665876 - 35665932
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
35665876 |
aggctaaaatatggttttaatccctacaaatatgcctcgttttggttttagtccctg |
35665932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 39719643 - 39719587
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
39719643 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttagttttagtccctg |
39719587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 44841359 - 44841411
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
44841359 |
taaaatatggttttgatccctgcaaatatgcctcgttttgattttagtccctg |
44841411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 45073313 - 45073369
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| || |||||||||||||| |||||| |
|
|
| T |
45073313 |
aggctaaaatatggttttagtccctgcaaataagcctcgttttggttttaatccctg |
45073369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 25547490 - 25547435
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
25547490 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
25547435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 30352904 - 30352849
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
30352904 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagtccctg |
30352849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 31732101 - 31732156
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||| ||||| |||||| |
|
|
| T |
31732101 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccctg |
31732156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 810 - 861
Target Start/End: Original strand, 34877777 - 34877828
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||||||||||||| |
|
|
| T |
34877777 |
taaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccct |
34877828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 855
Target Start/End: Complemental strand, 34878128 - 34878077
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |||||||||||||| |
|
|
| T |
34878128 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggtttta |
34878077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 750 - 805
Target Start/End: Original strand, 35759113 - 35759168
Alignment:
| Q |
750 |
tatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||| ||||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
35759113 |
tatttttttaacagaatatttatataaaatcaattccgtggagaccaaaatttgaa |
35759168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 811 - 862
Target Start/End: Original strand, 37372441 - 37372492
Alignment:
| Q |
811 |
aaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
37372441 |
aaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
37372492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 806 - 857
Target Start/End: Complemental strand, 45021857 - 45021806
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| || ||||||||||||| |
|
|
| T |
45021857 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagt |
45021806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 855
Target Start/End: Complemental strand, 46648718 - 46648667
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
46648718 |
aaaggctaaaatatggttttagtctctgcaaatatgcctcgttttggtttta |
46648667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 46829312 - 46829257
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| || |||||||||||||||||| |
|
|
| T |
46829312 |
ggctaaaatatggttttgatccctgcaaatatgtctcattttggttttagtccctg |
46829257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 806 - 860
Target Start/End: Original strand, 20355407 - 20355461
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
20355407 |
aggctaaaatatgattttgatccttgcaaatatgactcgttttggttgtagtccc |
20355461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 24717532 - 24717478
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| | | |||||| |||||||||||||||||||| |
|
|
| T |
24717532 |
ggctaaaatatggttttggtccctaccaatatgtctcgttttggttttagtccct |
24717478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 37527421 - 37527367
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
37527421 |
gctaaaatatggttttggtccctccaaatatgtcttgttttggttttagtccctg |
37527367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 46304084 - 46304138
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| |||| || | ||||||||||| |||||||||||||||||| |
|
|
| T |
46304084 |
aaggctaaaatatgattttagttcctgcaaatatgcctcgttttggttttagtcc |
46304138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 857
Target Start/End: Complemental strand, 48359075 - 48359025
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
48359075 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagt |
48359025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 1559341 - 1559398
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||| |||||||| ||||| |||||| |
|
|
| T |
1559341 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttaatccctg |
1559398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 5308688 - 5308632
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
5308688 |
aaggctaaaatatg-ttttagtccctgcaaatatacctcgttttggttttagtccctg |
5308632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 17854151 - 17854204
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
17854151 |
ctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
17854204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 19783814 - 19783867
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
19783814 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtcc |
19783867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 1007229 - 1007177
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||| |||||||| ||||||||| |
|
|
| T |
1007229 |
ggctaaaatatggttttagtccctccaaatatgcctcgttttgattttagtcc |
1007177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 3807863 - 3807919
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||| | |||||||||| |||||||||||||||| |||| |
|
|
| T |
3807863 |
aggctaaaatatagttttggttcctgcaaatatgtctcgttttggttttagttcctg |
3807919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 6892261 - 6892205
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| | ||||||| ||||||||||| |
|
|
| T |
6892261 |
aggctaaaatatggttttggtccctgcaaaaatgtcttgttttgggtttagtccctg |
6892205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 855
Target Start/End: Complemental strand, 6911247 - 6911199
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| | |||||||||||||| |
|
|
| T |
6911247 |
ggctaaaatatggttttggttcctgcaaatatacctcgttttggtttta |
6911199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 21554393 - 21554445
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| |||| |||| || |||||||| |||||||||||||||||| |
|
|
| T |
21554393 |
ggctaaaatatgattttagtccctgaaaatatgcctcgttttggttttagtcc |
21554445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 22539929 - 22539985
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| | ||||||||| || ||||||||||||| |||| |
|
|
| T |
22539929 |
aggctaaaatatggttttgatccctccaaatatgcctcattttggttttagttcctg |
22539985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 35210181 - 35210237
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
35210181 |
aggctaaaatatgattttgatcccggcaaatatgactcgttttggttttagtccctg |
35210237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 38486791 - 38486739
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||| |||||||||||||||| |
|
|
| T |
38486791 |
aggctaaaatatggttttgatccctgtaaatatgccccgttttggttttagtc |
38486739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 6911079 - 6911134
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||| |||||||| ||||||||| |
|
|
| T |
6911079 |
aaaggctaaaatatgattttggtccttataaatatgtctcgttttgattttagtcc |
6911134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 811 - 858
Target Start/End: Original strand, 6954862 - 6954909
Alignment:
| Q |
811 |
aaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
6954862 |
aaaatatggttttggtccctgcaaatatatctcgttttggttttagtc |
6954909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 810 - 857
Target Start/End: Original strand, 25547256 - 25547303
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
25547256 |
taaaatatggttttaatccctgcaaatatgcctcgttttggttttagt |
25547303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 28528905 - 28528960
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| | || ||||||| |||||| |||||||||||||| |
|
|
| T |
28528905 |
ggctaaaatatggttttggttcctgtaaatatgtctcgtttgggttttagtccctg |
28528960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 858
Target Start/End: Original strand, 39719353 - 39719404
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||| || |||||||||||||| |
|
|
| T |
39719353 |
ggctaaaatatggttttagtccctacaaatatgcctcattttggttttagtc |
39719404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 859
Target Start/End: Original strand, 43300613 - 43300664
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||| || | |||||||||| |||||||||||||||||| |
|
|
| T |
43300613 |
gctaaaatatggttttagttcctgcaaatatgtctcgttttggttttagtcc |
43300664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 810 - 861
Target Start/End: Complemental strand, 45671545 - 45671494
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||| |||||||||||| |
|
|
| T |
45671545 |
taaaatatggttttagtcattgcaaatatgtctcgttttagttttagtccct |
45671494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 5355045 - 5355003
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
5355045 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
5355003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 16940835 - 16940877
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
16940835 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
16940877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 28263074 - 28263016
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||| | |||||| |||||||||||| |
|
|
| T |
28263074 |
aaagactaaaatatggttttgatccctgcaaatatgtattgttttgattttagtccctg |
28263016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 30709323 - 30709377
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||| ||||||||| |||| |||| | ||||||||| |||||||||||||||||| |
|
|
| T |
30709323 |
aaggttaaaatatgattttagtccctacaaatatgcctcgttttggttttagtcc |
30709377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 31503417 - 31503475
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||||| || || ||||||| || |||||||||||||||||| |
|
|
| T |
31503417 |
aaaggttaaaatatggttttggcccctgtaaatatgtctctttttggttttagtccctg |
31503475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 35665948 - 35665990
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
35665948 |
ttttggtccttgcaaatatgtctcgttttggttttggtccctg |
35665990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 38186763 - 38186709
Alignment:
| Q |
805 |
aaggctaaaatatggtttt-ggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||| ||||||||||||||||| |
|
|
| T |
38186763 |
aaggctaaaatatgatttttggtccctgcaaatatgtctcgttttggttttagtc |
38186709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 41054163 - 41054121
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
41054163 |
ttttggtccctgcaaatatgcctcattttggttttagtccctg |
41054121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 489074 - 489017
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
489074 |
aaggctaaaatatgattttagtctctgcaaatatgtctcgttttgattttagtccctg |
489017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 808 - 857
Target Start/End: Original strand, 18022368 - 18022417
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
18022368 |
gctaaaatatggttttagtccccgcaaatatgtctcgttttggttttagt |
18022417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 839
Target Start/End: Complemental strand, 25046300 - 25046267
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatg |
839 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
25046300 |
aggctaaaatatgattttggtccttgcaaatatg |
25046267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 839
Target Start/End: Complemental strand, 30513340 - 30513307
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatg |
839 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
30513340 |
aggctaaaatatgattttggtccttgcaaatatg |
30513307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 808 - 857
Target Start/End: Complemental strand, 41365213 - 41365164
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||| || | |||||||||| |||||||||||||||| |
|
|
| T |
41365213 |
gctaaaatatggttttagttcccgcaaatatgcctcgttttggttttagt |
41365164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 2e-24; HSPs: 173)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 2e-24
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 30215419 - 30215481
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30215419 |
aaaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
30215481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 14003408 - 14003468
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003408 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
14003468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 14003744 - 14003683
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14003744 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
14003683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 15842825 - 15842764
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15842825 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
15842764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 24358615 - 24358675
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24358615 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
24358675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 25705450 - 25705390
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25705450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
25705390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 29865512 - 29865456
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29865512 |
aggctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtccctg |
29865456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 5334751 - 5334810
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5334751 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
5334810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 5335040 - 5334981
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5335040 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
5334981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 20131681 - 20131622
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20131681 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
20131622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 2481190 - 2481252
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2481190 |
aaaggctaaaatatggttttggtacttgcaaatatgtctcgttttggttttagtccctgcaaa |
2481252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 809 - 866
Target Start/End: Original strand, 146328 - 146385
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
146328 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
146385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 2481559 - 2481502
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2481559 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
2481502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 4423893 - 4423950
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4423893 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4423950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 16522989 - 16523046
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16522989 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 24358947 - 24358886
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24358947 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctgcaaa |
24358886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 801 - 862
Target Start/End: Complemental strand, 24483897 - 24483836
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
24483897 |
ttgaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24483836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 29859874 - 29859817
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29859874 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
29859817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 33576119 - 33576058
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33576119 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
33576058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 37911122 - 37911065
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
37911122 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttaatccctg |
37911065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 810 - 866
Target Start/End: Original strand, 15842464 - 15842520
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15842464 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
15842520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 16523326 - 16523270
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16523326 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
16523270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 801 - 865
Target Start/End: Original strand, 16673405 - 16673469
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| || ||||||||||||||||||||| |
|
|
| T |
16673405 |
ttgaaaggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctgcaa |
16673469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 16673772 - 16673712
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
16673772 |
aggctaaaatatggttttggtccctgcaaatatgcctcgtttttgttttagtccctgcaaa |
16673712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 20131316 - 20131376
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20131316 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
20131376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 810 - 866
Target Start/End: Original strand, 29859490 - 29859546
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29859490 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
29859546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 41451836 - 41451896
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41451836 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
41451896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 43592045 - 43592101
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43592045 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
43592101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 146690 - 146635
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
146690 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
146635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 3172535 - 3172480
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3172535 |
aaaggctaaaatatgattttggtccttgcaaatatgcctcgttttggttttagtcc |
3172480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 746 - 805
Target Start/End: Complemental strand, 20506763 - 20506704
Alignment:
| Q |
746 |
aaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20506763 |
aaaatatttttttaacagaatatttatataaaatcaattttgtggagaccaaaatttgaa |
20506704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 3838263 - 3838209
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3838263 |
gctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
3838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 25705082 - 25705140
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
25705082 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25705140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 26814232 - 26814174
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26814232 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26814174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 37271736 - 37271794
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37271736 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37271794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 38980256 - 38980198
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38980256 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38980198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 41693671 - 41693729
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
41693671 |
aaaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
41693729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 4424187 - 4424130
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
4424187 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
4424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 16900208 - 16900151
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16900208 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16900151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 16993599 - 16993542
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16993599 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16993542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 18113087 - 18113144
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
18113087 |
aaggctaaaatatggttttggtccctgcaaatatgcctagttttggttttagtccctg |
18113144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 801 - 862
Target Start/End: Original strand, 19183776 - 19183837
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19183776 |
ttgaaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
19183837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 19184153 - 19184096
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19184153 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19184096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 33732860 - 33732917
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
33732860 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33732917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 37272104 - 37272047
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37272104 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
37272047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 43789194 - 43789137
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||||||||||||||||||||||||| |
|
|
| T |
43789194 |
aaggctaaaatatggttttagttcctgcaaatatgcttcgttttggttttagtccctg |
43789137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 13215059 - 13215115
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13215059 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13215115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 33575751 - 33575811
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33575751 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaaa |
33575811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 44559061 - 44559117
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44559061 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
44559117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 1497610 - 1497665
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
1497610 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
1497665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 809 - 864
Target Start/End: Complemental strand, 1497943 - 1497888
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgca |
864 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1497943 |
ctaaaatatggttttattccttgcaaatatgcctcgttttggttttagtccctgca |
1497888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 4042607 - 4042662
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
4042607 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
4042662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 18113454 - 18113399
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| |||||| |
|
|
| T |
18113454 |
ggctaaaatatggttttggtccctacaaatatgcttcgttttggttttaatccctg |
18113399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 803 - 862
Target Start/End: Original strand, 24483396 - 24483455
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||| ||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24483396 |
gaaaagctaaaatatggctttagtccttgcaaatatgcctcgttttggttttagtccctg |
24483455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 27311070 - 27311015
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
27311070 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttggttttagtccct |
27311015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 34317798 - 34317853
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
34317798 |
ggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
34317853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 807 - 865
Target Start/End: Original strand, 4794130 - 4794188
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
4794130 |
ggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaa |
4794188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 8046326 - 8046384
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8046326 |
aaaggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
8046384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 11713848 - 11713790
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11713848 |
aaaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
11713790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 17541379 - 17541437
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
17541379 |
aaaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
17541437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 20939324 - 20939270
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
20939324 |
gctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
20939270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 22881611 - 22881665
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22881611 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22881665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 807 - 861
Target Start/End: Original strand, 27109073 - 27109127
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
27109073 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtccct |
27109127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 29182165 - 29182219
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
29182165 |
aaaggctaaaatatgattttggtccttgcaaatatgtttcattttggttttagtc |
29182219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 31326255 - 31326197
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
31326255 |
aaaggctaaaatatagttttagtccttgcaaatatgcctcgttttagttttagtccctg |
31326197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 31644838 - 31644892
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
31644838 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
31644892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 759 - 805
Target Start/End: Original strand, 36520881 - 36520927
Alignment:
| Q |
759 |
aacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36520881 |
aacataatatttatataaaatcaattttgtggagaccaaaatttgaa |
36520927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 37228730 - 37228784
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
37228730 |
aaaggctaaaatatggttttggtccctgcaaatatgtatcgttttggttttagtc |
37228784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 807 - 861
Target Start/End: Original strand, 42695868 - 42695922
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
42695868 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
42695922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 797 - 859
Target Start/End: Complemental strand, 42696213 - 42696151
Alignment:
| Q |
797 |
aaatttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||| ||| ||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
42696213 |
aaattttaaaagctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtcc |
42696151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 43672321 - 43672263
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
43672321 |
aaaggctaaaatatgattttggtccctgcaaatatgttttgttttggttttagtccctg |
43672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 1137983 - 1138036
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
1137983 |
ctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
1138036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 2265399 - 2265342
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2265399 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtccctg |
2265342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 17302145 - 17302088
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
17302145 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
17302088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 25954428 - 25954371
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
25954428 |
aaggttaaaatatggttttagtccttgcaaatatgcctcgttttgattttagtccctg |
25954371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 32476093 - 32476150
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
32476093 |
aaggctaaaatatggttttgatccctgcaaatatgcctcattttggttttagtccctg |
32476150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 801 - 862
Target Start/End: Complemental strand, 36806902 - 36806841
Alignment:
| Q |
801 |
ttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
36806902 |
ttgaatggccaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
36806841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 36815837 - 36815780
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
36815837 |
aaggctaaaatatggttttggtccatgcaaatatgtctcgttttggttttagttcctg |
36815780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 38731827 - 38731884
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38731827 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38731884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 42358697 - 42358754
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
42358697 |
aaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
42358754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 43671932 - 43671989
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
43671932 |
aaggctaaaatatggtttttgtccctgtaaatatgcttcgttttggttttagttcctg |
43671989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 43710710 - 43710653
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43710710 |
aaggctaaaatatgattttagcccttgcaaatatgcctcgttttggttttagtccctg |
43710653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 43788857 - 43788910
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
43788857 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
43788910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 44073809 - 44073752
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
44073809 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
44073752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 44985623 - 44985676
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
44985623 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
44985676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 3671002 - 3671058
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
3671002 |
aggctaaaatatggttttagtccatgcaaatatgcctcgttttgattttagtccctg |
3671058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 3832634 - 3832586
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
3832634 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttagtc |
3832586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 9195207 - 9195151
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| | || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9195207 |
aggctaaaatatggttttagaccctgcaaatatgcctcgttttggttttagtccctg |
9195151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 10671629 - 10671685
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
10671629 |
aggctaaaatatggttttggtccctgcaaatatatctcgttttggttttagtccctg |
10671685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 11788417 - 11788361
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
11788417 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11788361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 13850881 - 13850833
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
13850881 |
taaaatatggttttggttcctgcaaatatgcttcgttttggttttagtc |
13850833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 26239161 - 26239101
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
26239161 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctgcaaa |
26239101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 26707872 - 26707928
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
26707872 |
aggctaaaatatggttttaatccctgcaaatatacttcgttttggttttagtccctg |
26707928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 37910755 - 37910811
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| || |||| ||||||||||||| |
|
|
| T |
37910755 |
aggctaaaatatggttttgatccttgcaaatatgcctcattttagttttagtccctg |
37910811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 40302340 - 40302284
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40302340 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
40302284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 43597153 - 43597209
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43597153 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccctg |
43597209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 3172017 - 3172072
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
3172017 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcattttggttttagtcc |
3172072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 3671192 - 3671137
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3671192 |
ggctcaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
3671137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 4042890 - 4042831
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||| |||||||||||||||||| |||||| |
|
|
| T |
4042890 |
ggctaaaatatggtttaggtccctgcaaatatgtctcgttttggttttagtccttgcaaa |
4042831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 5790558 - 5790613
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| || |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
5790558 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
5790613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 5790899 - 5790844
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5790899 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
5790844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 8046648 - 8046593
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
8046648 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
8046593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 11713485 - 11713540
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
11713485 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
11713540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 25954112 - 25954167
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
25954112 |
aaaggctaaaatatgtttttagtccctgcaaatatgtttcgttttggttttagtcc |
25954167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 26813866 - 26813921
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26813866 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26813921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 36622250 - 36622305
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
36622250 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36622305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 40124966 - 40125021
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||||||||| |||| |
|
|
| T |
40124966 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagttcctg |
40125021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 41694003 - 41693948
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41694003 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
41693948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 858
Target Start/End: Complemental strand, 41791312 - 41791261
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
41791312 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggtttaagtc |
41791261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 10374775 - 10374829
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
10374775 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10374829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 23732331 - 23732274
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
23732331 |
aaaggctaaaatatggttttggtctctgcaaatatgcctcgttttgg-tttagtccctg |
23732274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 27310873 - 27310930
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||| ||||||||||| |
|
|
| T |
27310873 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgg-tttagtccctg |
27310930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 29865222 - 29865276
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29865222 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
29865276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 33733241 - 33733187
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
33733241 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccct |
33733187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 40301972 - 40302030
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| || |||| ||||||||||||| |
|
|
| T |
40301972 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccctg |
40302030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 45442698 - 45442644
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
45442698 |
aaggctaaaatatgattttagtccttgcaaatatgtctcgttttggttttagtcc |
45442644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 7814244 - 7814301
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
7814244 |
aaggctaaaatattgttttagtccctgtaaatatgcctcgttttggttttagtccctg |
7814301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 10671942 - 10671889
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
10671942 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
10671889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 19831506 - 19831563
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
19831506 |
aaggttaaaatatggttttagtctttgcaaatatgtttcgttttggttttagttcctg |
19831563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 804 - 857
Target Start/End: Complemental strand, 36622587 - 36622534
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
36622587 |
aaagactaaaatatggttttagtccctgcaaatatgcatcgttttggttttagt |
36622534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 40125291 - 40125234
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| || |||| ||||||||||||| |
|
|
| T |
40125291 |
aaggctaaaatatgattttggtccctgcaaatatgcctcatttttgttttagtccctg |
40125234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 858
Target Start/End: Complemental strand, 44559407 - 44559358
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
44559407 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
44559358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 1138360 - 1138304
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
1138360 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttagttttagtccctg |
1138304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 1295544 - 1295492
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| | | |||||||||| |||||||||||||||||||||| |
|
|
| T |
1295544 |
taaaatatggttttgattcctgcaaatatgtttcgttttggttttagtccctg |
1295492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 7814738 - 7814682
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
7814738 |
aggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
7814682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 20658060 - 20658116
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
20658060 |
aggctaaaacatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
20658116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 23989837 - 23989889
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
23989837 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
23989889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 23990193 - 23990145
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
23990193 |
taaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
23990145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 30215872 - 30215816
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
30215872 |
aggctaaaatatggttttggtccctgcaaatatatcgcgttttggttttagtccctg |
30215816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 31909479 - 31909428
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
31909479 |
aggctaaaatatggttttggtccctgcaaatatgcctc-ttttggttttagtc |
31909428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 34318083 - 34318031
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||| ||||||||| |
|
|
| T |
34318083 |
ggctaaaatatggttttggtccctacaaatatgcctcgttttgattttagtcc |
34318031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 753 - 805
Target Start/End: Complemental strand, 36076526 - 36076474
Alignment:
| Q |
753 |
ttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||||||| ||||||||||| |
|
|
| T |
36076526 |
ttttttaacataatatttatataaaatcaattgtgtggagatcaaaatttgaa |
36076474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 752 - 804
Target Start/End: Original strand, 37605872 - 37605924
Alignment:
| Q |
752 |
tttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttga |
804 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
37605872 |
tttttttaacagaatatttatataaaatcaattttgtggagactaaaatttga |
37605924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 38639411 - 38639463
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
38639411 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
38639463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 44985985 - 44985929
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44985985 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
44985929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 9195054 - 9195109
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
9195054 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
9195109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 10375069 - 10375014
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
10375069 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttaatccctg |
10375014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 731 - 805
Target Start/End: Original strand, 11033071 - 11033146
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaa-ataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||| ||||| || |||||||| |||| || ||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
11033071 |
aatgtggtctttaaaaatatatttttttaacctactattttatataaaatcaattttgtggagaccaaaatttgaa |
11033146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 12835325 - 12835380
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
12835325 |
ggctaaaatatgattttagtccctgcaaatatgcctcattttggttttagtccctg |
12835380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 31226077 - 31226022
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
31226077 |
ggctaaaatatggttttactccctgcaaatatgcctcgttttggttttactccctg |
31226022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 31325920 - 31325975
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
31325920 |
ggctaaaatatggttctagtccctgcaaatatgcatcgttttagttttagtccctg |
31325975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 34964159 - 34964104
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||| ||||||| ||||| |
|
|
| T |
34964159 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttagttttagcccctg |
34964104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 810 - 857
Target Start/End: Complemental strand, 35686335 - 35686288
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
35686335 |
taaaatatggttttgatccctgtaaatatgcttcgttttggttttagt |
35686288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 810 - 857
Target Start/End: Complemental strand, 37229039 - 37228992
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
37229039 |
taaaatatggttttggtccctgcaaatatatttcgttttggttttagt |
37228992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 10665297 - 10665239
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
10665297 |
aaaggctaaaatatagttttagtctctgcaaatatgcatcgttttggttttagttcctg |
10665239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 17541778 - 17541724
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
17541778 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
17541724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 26238810 - 26238868
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
26238810 |
aaaggttaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
26238868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 35155622 - 35155564
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| | |||||| |||||||||||| |
|
|
| T |
35155622 |
aaaggctaaaatatggttttggtccctgaaaatatgtcttgttttgattttagtccctg |
35155564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 3837931 - 3837988
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
3837931 |
aaggctaaaatatagttttagtccctgcaaatatgtctcgttttcgttttagtccctg |
3837988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 808 - 861
Target Start/End: Original strand, 4842865 - 4842918
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
4842865 |
gctaaaatatggttttggatcctgcaaatatgtctcgttttggttttagtccct |
4842918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 16968550 - 16968607
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| |||| | ||||||||| | ||||||||||||||||||| |
|
|
| T |
16968550 |
aaggttaaaatatggttttagtccctacaaatatgccttgttttggttttagtccctg |
16968607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 804 - 861
Target Start/End: Original strand, 17301981 - 17302036
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| | |||||||||||||||||||| |
|
|
| T |
17301981 |
aaaggctaaaatatggttttggtcc-tgaaaatattc-tcgttttggttttagtccct |
17302036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 31225713 - 31225770
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||| |||||||| ||||||| |||| |
|
|
| T |
31225713 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttgattttagttcctg |
31225770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 813 - 866
Target Start/End: Original strand, 35155298 - 35155351
Alignment:
| Q |
813 |
aatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||||||||| |||||| |
|
|
| T |
35155298 |
aatatggttttagtccctgcaaatatgtctcgttttggttttagtccttgcaaa |
35155351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 41791020 - 41791073
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| || |||||||| || |||||||||||||||||| |
|
|
| T |
41791020 |
ctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
41791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 43597501 - 43597444
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||| |||||| ||||||||||||||||||||| |
|
|
| T |
43597501 |
aaggctaaaatatgattttagtccctgctaatatgtctcgttttggttttagtccctg |
43597444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 10664983 - 10665039
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| | |||||||||| |
|
|
| T |
10664983 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgatattagtccctg |
10665039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 854
Target Start/End: Complemental strand, 13215366 - 13215318
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||| |
|
|
| T |
13215366 |
aggctaaaatatgggtttggtccctgcaaatatgtctcgttttggtttt |
13215318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 17912808 - 17912760
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||| || | ||||||||||| ||||||||||||||||| |
|
|
| T |
17912808 |
taaaatatggttttagttcctgcaaatatgcctcgttttggttttagtc |
17912760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 23732039 - 23732091
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
23732039 |
ggctaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtcc |
23732091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 809 - 857
Target Start/End: Complemental strand, 25300038 - 25299991
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
25300038 |
ctaaaatatggttttggtccctgcaaatatgtttc-ttttggttttagt |
25299991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 32691312 - 32691368
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| |||||||||||||| |||||| |
|
|
| T |
32691312 |
aggctaaaatatggttttagtttctgcaaatatgcctcgttttggttttaatccctg |
32691368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 38979889 - 38979945
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgct-tcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
38979889 |
ggctaaaatatggttttagtccctgcaaatatattctcgttttggttttagtccctg |
38979945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 40786459 - 40786515
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || |||||||||| ||||||||||||||||||||| |
|
|
| T |
40786459 |
aggctaaaatatggttttattcactgcaaatatgtctcgttttggttttagtccctg |
40786515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 812 - 858
Target Start/End: Complemental strand, 4794468 - 4794422
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
4794468 |
aaatatggttttggtccctacaaatatgtctcgttttggttttagtc |
4794422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 10671703 - 10671745
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
10671703 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
10671745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 855
Target Start/End: Original strand, 13802484 - 13802534
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||| || |||| |||||| | |||||||||||||| |
|
|
| T |
13802484 |
aaggctaaaatatggttttagttcttgtaaatattcctcgttttggtttta |
13802534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 854
Target Start/End: Original strand, 35155365 - 35155399
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35155365 |
ttttggtccctgcaaatatgcttcgttttggtttt |
35155399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 38231823 - 38231769
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||| ||||||||| ||||| ||| | |||||||||||||||||| ||||||||| |
|
|
| T |
38231823 |
aaggttaaaatatgattttgatccctccaaatatgcttcgttttgattttagtcc |
38231769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 43672005 - 43672047
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
43672005 |
ttttggtccctgcaaatatgtttcgttttggttttcgtccctg |
43672047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 858
Target Start/End: Complemental strand, 44994064 - 44994010
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||| ||||||||| |
|
|
| T |
44994064 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttagttttagtc |
44994010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 25299747 - 25299800
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
25299747 |
ctaaaatatgattttggtccctgcaaatatgactcgttttaattttagtccctg |
25299800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 39367762 - 39367709
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||| ||| ||| || |||||||||| |||||||||||||| |
|
|
| T |
39367762 |
aaggctaaaatatggtcttgatccctgtaaatatgctttattttggttttagtc |
39367709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 7e-24; HSPs: 175)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 9496725 - 9496664
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496725 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
9496664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 3e-23
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 7326085 - 7326145
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7326085 |
aggctaaaatatggttttggtccttgcaaatatgcctcgttttggttttagtccctgcaaa |
7326145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 56; E-Value: 1e-22
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 37536419 - 37536360
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37536419 |
ggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
37536360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 4017303 - 4017241
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4017303 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgcaaa |
4017241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 37536083 - 37536145
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37536083 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
37536145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 10540784 - 10540727
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10540784 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
10540727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 28346392 - 28346453
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28346392 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
28346453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 34963298 - 34963359
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34963298 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
34963359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 4710221 - 4710161
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4710221 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
4710161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 11019858 - 11019798
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11019858 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
11019798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 28346759 - 28346699
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28346759 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
28346699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 32726272 - 32726212
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32726272 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
32726212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 2728597 - 2728538
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2728597 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
2728538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 35097692 - 35097633
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35097692 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
35097633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 7420227 - 7420289
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7420227 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
7420289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 11976370 - 11976428
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11976370 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
11976428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 32725904 - 32725966
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32725904 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
32725966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 11019518 - 11019579
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11019518 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
11019579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 3511905 - 3511965
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3511905 |
aggctaaaatatggttttggtcccttcaaatatgcctcgttttggttttagtccctgcaaa |
3511965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 3512267 - 3512207
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3512267 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
3512207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 10337450 - 10337390
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
10337450 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctgcaaa |
10337390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 35097327 - 35097387
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35097327 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
35097387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 35346999 - 35346939
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35346999 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
35346939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 1778564 - 1778623
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1778564 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
1778623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 799 - 858
Target Start/End: Complemental strand, 5357771 - 5357712
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5357771 |
atttgaaacgctaaaatatgattttggtccctgcaaatatgcttcgttttggttttagtc |
5357712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 7326421 - 7326366
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7326421 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
7326366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 10873280 - 10873221
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10873280 |
ggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctgcaaa |
10873221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 803 - 862
Target Start/End: Complemental strand, 27341595 - 27341536
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27341595 |
gaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27341536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 34963664 - 34963605
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34963664 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
34963605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 35346629 - 35346688
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35346629 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
35346688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 40844156 - 40844211
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40844156 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
40844211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 2728229 - 2728291
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2728229 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
2728291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 806 - 860
Target Start/End: Complemental strand, 8094842 - 8094788
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8094842 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccc |
8094788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 8298978 - 8298920
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8298978 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 9175009 - 9175067
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9175009 |
aaaggctaaaatatgattttggtccttgcaaatatgtctcgttttggttttagtccctg |
9175067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 10872912 - 10872970
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
10872912 |
aaaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
10872970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 20277689 - 20277747
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
20277689 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
20277747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 20984143 - 20984201
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
20984143 |
aaaggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
20984201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 21064316 - 21064374
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
21064316 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttagttttagtccctg |
21064374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 29488113 - 29488055
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29488113 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
29488055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 30969399 - 30969453
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
30969399 |
gctaaaatatggttttggtccttacaaatatgtttcgttttggttttagtccctg |
30969453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 806 - 860
Target Start/End: Original strand, 33636321 - 33636375
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33636321 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccc |
33636375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 43477160 - 43477218
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43477160 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
43477218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 4474046 - 4473989
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4474046 |
aaggctaaaatatggttttgatccctgcaaatatgcctcgttttggttttagtccctg |
4473989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 7420592 - 7420535
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7420592 |
aaggctaaaatatggttttggtcactgcaaatatgcctcgttttggttttagtccctg |
7420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 14239082 - 14239025
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
14239082 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14239025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 22917562 - 22917619
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
22917562 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
22917619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 24187567 - 24187624
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24187567 |
aaggctaaaatatggttttaatccctgcaaatatgcttcgttttggttttagtccctg |
24187624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 4473703 - 4473763
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
4473703 |
aggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaa |
4473763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 9496340 - 9496400
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
9496340 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaa |
9496400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 10337118 - 10337174
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
10337118 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10337174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 11976733 - 11976677
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11976733 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
11976677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 13154885 - 13154941
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
13154885 |
aggctaaaatatagttttgatccttgcaaatatgcctcgttttggttttagtccctg |
13154941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 18549200 - 18549252
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
18549200 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtc |
18549252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 19494414 - 19494358
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19494414 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
19494358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 28323847 - 28323903
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||| | |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28323847 |
aaggctaaaatatggttgtagtccctgcaaatatgcttcgttttggttttagtccct |
28323903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 1162909 - 1162964
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
1162909 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttgattttagtccctg |
1162964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 4621354 - 4621299
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
4621354 |
ggctaaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctg |
4621299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 5357422 - 5357477
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
5357422 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccct |
5357477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 808 - 859
Target Start/End: Original strand, 6146517 - 6146568
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
6146517 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
6146568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 7186004 - 7185949
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
7186004 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
7185949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 8298587 - 8298642
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8298587 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
8298642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 14489073 - 14489018
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14489073 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14489018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 16789369 - 16789314
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16789369 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16789314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 32418315 - 32418370
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
32418315 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
32418370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 42132864 - 42132923
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||| |
|
|
| T |
42132864 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttaatccctgcaaa |
42132923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 42133154 - 42133099
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
42133154 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
42133099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 1525806 - 1525860
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
1525806 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtc |
1525860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 866
Target Start/End: Original strand, 4016906 - 4016964
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
4016906 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctgcaaa |
4016964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 6146948 - 6146894
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
6146948 |
gctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
6146894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 9832212 - 9832270
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| || |||||||||||| |||||| |
|
|
| T |
9832212 |
aaaggctaaattatggttttggtccttgcaaatatgttttgttttggttttaatccctg |
9832270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 14238748 - 14238806
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14238748 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
14238806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 20984513 - 20984455
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
20984513 |
aaaggctaaaatatggttttggtccctacaaatatgtctcgttttggttttagtccctg |
20984455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 858
Target Start/End: Complemental strand, 24090487 - 24090437
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
24090487 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtc |
24090437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 3680803 - 3680742
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
3680803 |
aaggctaaaatatgattttgatccctgcaaatatgcctcgttttggttttggtccctgcaaa |
3680742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 14495067 - 14495124
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
14495067 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
14495124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 16644046 - 16643989
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
16644046 |
aaggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
16643989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 20278058 - 20278005
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
20278058 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
20278005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 21064685 - 21064632
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||| |||||||||||||||||| |
|
|
| T |
21064685 |
aggctaaaatatggttttggtccctgcagatatgcctcgttttggttttagtcc |
21064632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 804 - 865
Target Start/End: Complemental strand, 24187900 - 24187839
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
||||||||||||||| |||| |||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
24187900 |
aaaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccctgcaa |
24187839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 804 - 861
Target Start/End: Complemental strand, 27117979 - 27117922
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||| |||||| |
|
|
| T |
27117979 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttggtccct |
27117922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 753 - 805
Target Start/End: Complemental strand, 1214409 - 1214357
Alignment:
| Q |
753 |
ttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
1214409 |
ttttttaacataatatttatataaaatcaattttgtggagaccaaaaattgaa |
1214357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 1526173 - 1526117
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
1526173 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
1526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 13232201 - 13232253
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13232201 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13232253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 14496814 - 14496870
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||| |||||||||||||||||||| |
|
|
| T |
14496814 |
aaggctaaaatatggttttagttcctgcaaatatgcgtcgttttggttttagtccct |
14496870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 16643660 - 16643716
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
16643660 |
aggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
16643716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 17073806 - 17073862
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
17073806 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17073862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 17574464 - 17574408
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
17574464 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
17574408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 25600229 - 25600285
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
25600229 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctg |
25600285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 28399036 - 28398980
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
28399036 |
aggctaaaatatgattttagtccctgcaaatatggttcgttttggttttagtccctg |
28398980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 28497616 - 28497564
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28497616 |
taaaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
28497564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 29158353 - 29158409
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
29158353 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
29158409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 33526052 - 33526104
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33526052 |
ggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtcc |
33526104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 33526413 - 33526357
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
33526413 |
aggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
33526357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 1685111 - 1685166
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
1685111 |
aaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
1685166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 4375692 - 4375747
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
4375692 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
4375747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 7272751 - 7272696
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| | || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7272751 |
ggctaaaatatggttttagcccctgcaaatatgcctcgttttggttttagtccctg |
7272696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 10540448 - 10540503
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
10540448 |
aggctaaaatattgttttggtctctgcaaatatgcctcgttttggttttagtccct |
10540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 10776499 - 10776444
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
10776499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
10776444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 24955011 - 24954956
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
24955011 |
aggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccct |
24954956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 28497252 - 28497307
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
28497252 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttagttttagtcc |
28497307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 40066820 - 40066765
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
40066820 |
ggctaaaatatggttttagtccctgcaaatatgccccgttttggttttagtccctg |
40066765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 807 - 857
Target Start/End: Complemental strand, 13232562 - 13232512
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
13232562 |
ggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagt |
13232512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 758 - 804
Target Start/End: Original strand, 13241121 - 13241167
Alignment:
| Q |
758 |
taacataatatttaaataaaatcaattttgtggagaccaaaatttga |
804 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13241121 |
taacagaatatttatataaaatcaattttgtggagaccaaaatttga |
13241167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 13779531 - 13779477
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||||| ||||| |
|
|
| T |
13779531 |
gctaaaatatggatttggtccctgcaaatatgcctcgttttggttttagcccctg |
13779477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 22650461 - 22650519
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
22650461 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
22650519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 25131447 - 25131393
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||| || | ||||||||||| |||||||||||||||||||| |
|
|
| T |
25131447 |
ggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagtccct |
25131393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 25600600 - 25600542
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
25600600 |
aaaggctaaaatatagttttggtccctgcaaatatgtcttgttttggttttagtccctg |
25600542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 752 - 802
Target Start/End: Original strand, 28430003 - 28430053
Alignment:
| Q |
752 |
tttttctaacataatatttaaataaaatcaattttgtggagaccaaaattt |
802 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28430003 |
tttttttaacagaatatttatataaaatcaattttgtggagaccaaaattt |
28430053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 40066494 - 40066552
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||| |||||||| |||| |
|
|
| T |
40066494 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagttcctg |
40066552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 7272418 - 7272471
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
7272418 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
7272471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 16789073 - 16789130
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
16789073 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
16789130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 18549571 - 18549518
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
18549571 |
ctaaaatatggttttcgtccctgcaaatatgtctcgttttggttttagtccctg |
18549518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 21125717 - 21125774
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
21125717 |
aaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttaatccctg |
21125774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 25131109 - 25131166
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
25131109 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
25131166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 28324183 - 28324126
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| | ||||||||||||||||||| |
|
|
| T |
28324183 |
aaggctaaaatatggttttggtccctacaaatatgtcttgttttggttttagtccctg |
28324126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 38930666 - 38930609
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
38930666 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttaatccctg |
38930609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 1408355 - 1408299
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| || |||| |||||||||||| |
|
|
| T |
1408355 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtccct |
1408299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 4376011 - 4375960
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
4376011 |
aggctaaaatatggttttagtccctgcaaatatgcttcg-tttggttttagtc |
4375960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 6469279 - 6469335
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
6469279 |
aggctaaaatatggctttcgtccctgcaaatatgcctcgttttggttttagttcctg |
6469335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 6469668 - 6469612
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
6469668 |
aggctaaaatatgattttggtcactgcaaatatgttacgttttggttttagtccctg |
6469612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 8094478 - 8094534
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8094478 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagtccctg |
8094534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 9175368 - 9175320
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
9175368 |
taaaatatggttttggtccctgtaaatatgcctcgttttggttttagtc |
9175320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 19494118 - 19494174
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
19494118 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
19494174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 19962994 - 19963050
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| || ||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
19962994 |
aggctaaaatatggtgttagtccttgcaaatatgtctcgttttagttttagtccctg |
19963050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 24815069 - 24815013
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| || |||||||||||||||||| |
|
|
| T |
24815069 |
aggctaaaatatggttttggcccctgcaaatatgtctcattttggttttagtccctg |
24815013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 25702511 - 25702567
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| || |||||||| ||||||| |||||||||||| |
|
|
| T |
25702511 |
aggctaaaatatggttttggtccctgtaaatatgcctcgttttaattttagtccctg |
25702567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 27117752 - 27117808
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
27117752 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctg |
27117808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 29487750 - 29487802
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
29487750 |
ggctaaaatatgattttcgtccctgcaaatatgtttcgttttggttttagtcc |
29487802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 29992301 - 29992245
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||||||||||||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
29992301 |
aggctcaaatatggttttgttccctgcaaatatgcctcgttttgattttagtccctg |
29992245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 32040074 - 32040130
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| | || |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
32040074 |
aggctaaaatatgatcttagtccctgcaaatatgtttcgttttggttttagtccctg |
32040130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35143845 - 35143789
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35143845 |
aggctaaaatatggttttaatccgtgtaaatatgcctcgttttggttttagtccctg |
35143789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35345618 - 35345562
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||| |||||||||||||| |||||| |
|
|
| T |
35345618 |
aggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttaatccctg |
35345562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 40492959 - 40493015
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| ||||||||||||||||||||| |
|
|
| T |
40492959 |
aggctaaaatatggttttagtacctgcaaatatgtctcgttttggttttagtccctg |
40493015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 42430120 - 42430068
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
42430120 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
42430068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 812 - 859
Target Start/End: Original strand, 24814710 - 24814757
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
24814710 |
aaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
24814757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 855
Target Start/End: Original strand, 44997928 - 44997979
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
44997928 |
aaaggctaaaatatgattttggtccctgcaaatatgcctcgttttgatttta |
44997979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 812 - 862
Target Start/End: Original strand, 3680532 - 3680582
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3680532 |
aaatatggttttgctccctgcaaatatgactcgttttggttttagtccctg |
3680582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 10755528 - 10755474
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||| ||||| ||||| |
|
|
| T |
10755528 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttaatccct |
10755474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 14488713 - 14488767
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||| ||||| |||| || |||||||| ||||||||||||||||| |
|
|
| T |
14488713 |
aaaggctaaaatatagttttagtccctgaaaatatgcctcgttttggttttagtc |
14488767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 29991912 - 29991966
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||| |||||||||||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
29991912 |
aaaggttaaaatatggttttggtctctgcaaatatgcctcgttttagttttagtc |
29991966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 40844538 - 40844480
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40844538 |
aaaggttaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccctg |
40844480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 2811783 - 2811730
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||| ||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
2811783 |
aaggttaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
2811730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 13779151 - 13779204
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
13779151 |
ctaaaatatggttttgatccctgcaaatatgtctcgttttggttttattccctg |
13779204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 808 - 860
Target Start/End: Complemental strand, 14495389 - 14495337
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
||||||||||||| || |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
14495389 |
gctaaaatatggtnttagtccccgcaaatatgcctcgttttggttttagtccc |
14495337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 804 - 861
Target Start/End: Original strand, 14847822 - 14847879
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||| ||||||||| ||||| ||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
14847822 |
aaaggttaaaatatgattttgatccctgcaaatatgcctcattttggttttagtccct |
14847879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 807 - 860
Target Start/End: Original strand, 15719656 - 15719709
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
||||||||||||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
15719656 |
ggctaaaatatggttttagtccctgcaaatatatctcgttttggttttagtccc |
15719709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 38930300 - 38930357
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||| |||||||||||||||| |||| |
|
|
| T |
38930300 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagttcctg |
38930357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 42429756 - 42429812
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||| || ||||||||||||||||| |
|
|
| T |
42429756 |
aaggctaaaatatggttttggtccctacaaatatgcctc-atttggttttagtccctg |
42429812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 13155252 - 13155196
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || | |||||||||| |||||||||||||| |||||| |
|
|
| T |
13155252 |
aggctaaaatatggtttttgttcctgcaaatatgtctcgttttggttttaatccctg |
13155196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 21126022 - 21125966
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||| |||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
21126022 |
aggctaaaatatagttttagtccatgtaaatatgactcgttttggttttagtccctg |
21125966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 24090117 - 24090173
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| |||| | ||||| |||||||| ||||||||||| |
|
|
| T |
24090117 |
aaggctaaaatatggttttggttcttgtagatatgtctcgttttgattttagtccct |
24090173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35115640 - 35115584
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||| | ||||||||||||| ||||||| |
|
|
| T |
35115640 |
aggctaaaatatggttttagtccctacaaatatacctcgttttggttttggtccctg |
35115584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 807 - 858
Target Start/End: Complemental strand, 1163274 - 1163223
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||| ||||||||| |
|
|
| T |
1163274 |
ggctaaaatatggttttagtccatgcaaatatgccccgttttagttttagtc |
1163223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 746 - 805
Target Start/End: Complemental strand, 17856953 - 17856894
Alignment:
| Q |
746 |
aaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||||||| || | |||||||| |||||||||||| |||| ||||||||||||||| |
|
|
| T |
17856953 |
aaaatattttttcaagagaatatttatataaaatcaattatgtgaagaccaaaatttgaa |
17856894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 855
Target Start/End: Complemental strand, 36044791 - 36044744
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||| ||||||| || |||||||||||||| |
|
|
| T |
36044791 |
gctaaaatatggttttggtccctgcaaatgtgtctcgttttggtttta |
36044744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 731 - 802
Target Start/End: Original strand, 42573169 - 42573240
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaattt |
802 |
Q |
| |
|
||||||| ||||| || |||||||||||||| ||||||| |||||||||||||| | |||| |||||||| |
|
|
| T |
42573169 |
aatgtggtctttaaaaatatatttttctaacaaaatatttgtataaaatcaattttatagagatcaaaattt |
42573240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 1778637 - 1778679
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
1778637 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
1778679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 850
Target Start/End: Original strand, 2811432 - 2811478
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttgg |
850 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
2811432 |
aaagactaaaatatggttttggtctctgtaaatatgcttcgttttgg |
2811478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 809 - 855
Target Start/End: Original strand, 10776150 - 10776196
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
10776150 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
10776196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 15930933 - 15930987
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| ||||||| | | |||||||| ||||||||||||||||||||| |
|
|
| T |
15930933 |
gctaaaatatgattttggttcctacaaatatgtctcgttttggttttagtccctg |
15930987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 760 - 802
Target Start/End: Original strand, 17844900 - 17844942
Alignment:
| Q |
760 |
acataatatttaaataaaatcaattttgtggagaccaaaattt |
802 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| |||||||| |
|
|
| T |
17844900 |
acataatatttatataaaatcaattttgtagagatcaaaattt |
17844942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 20277765 - 20277807
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
20277765 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctg |
20277807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 21064392 - 21064434
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
21064392 |
ttttagtccctgcaaatatgcttcgttttggttttggtccctg |
21064434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 857
Target Start/End: Original strand, 23939547 - 23939597
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| |||||||| |
|
|
| T |
23939547 |
ggctaaaatatggttttggtcactgcaaatatgtctcgttttagttttagt |
23939597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 858
Target Start/End: Complemental strand, 31445466 - 31445412
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||| |||||| ||| | ||||||||| || |||||||||||||| |
|
|
| T |
31445466 |
aaaggctaaaatatagttttgatccctacaaatatgcctcattttggttttagtc |
31445412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 809 - 859
Target Start/End: Complemental strand, 43727431 - 43727382
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
43727431 |
ctaaaatatggttttagtcct-gcaaatatgtctcgttttggttttagtcc |
43727382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 807 - 856
Target Start/End: Original strand, 1408005 - 1408054
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttag |
856 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||| ||||||| |
|
|
| T |
1408005 |
ggctaaaatatggttttagtccatgcaaatatgtctcgttttagttttag |
1408054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 758 - 804
Target Start/End: Original strand, 5725814 - 5725862
Alignment:
| Q |
758 |
taacataatatttaaataaaatcaattttg--tggagaccaaaatttga |
804 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||||||||||||||| |
|
|
| T |
5725814 |
taacataatatttatataaaatcaattttgtatagagaccaaaatttga |
5725862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 764 - 805
Target Start/End: Original strand, 25382264 - 25382305
Alignment:
| Q |
764 |
aatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| ||||||||||||||||| |||| |||||||||| |
|
|
| T |
25382264 |
aatatttatataaaatcaattttgtgaagactaaaatttgaa |
25382305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 839
Target Start/End: Complemental strand, 25702810 - 25702777
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatg |
839 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
25702810 |
aggctaaaatatggttttggtccctgcaaatatg |
25702777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 26530666 - 26530723
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||| || |||| |||||||| |||| |
|
|
| T |
26530666 |
aaggcttaaatatggttttagtccatgcaaatatgcctcattttagttttagttcctg |
26530723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 807 - 840
Target Start/End: Complemental strand, 30969717 - 30969684
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgc |
840 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
30969717 |
ggctaaaatatggttttggtccctgcaaatatgc |
30969684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 807 - 852
Target Start/End: Complemental strand, 40493157 - 40493112
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggtt |
852 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
40493157 |
ggctaaaatgtggttttagtccctgcaaatatgcctcgttttggtt |
40493112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 43727097 - 43727150
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| | |||||| ||||||| |||| |
|
|
| T |
43727097 |
ctaaaatatggttttagtccctgcaaatatgcattgttttgattttagttcctg |
43727150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 7e-24; HSPs: 161)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 7e-24
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 35876686 - 35876747
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35876686 |
aaggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctgcaaa |
35876747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 35928061 - 35928123
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35928061 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
35928123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 1381613 - 1381552
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1381613 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
1381552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 5917462 - 5917401
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5917462 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
5917401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 54; E-Value: 2e-21
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 40764413 - 40764474
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40764413 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
40764474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 1105149 - 1105089
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1105149 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
1105089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 19565832 - 19565772
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19565832 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
19565772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 6912497 - 6912556
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6912497 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
6912556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 20661311 - 20661256
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20661311 |
ggctaaaatatggttttggtccgtgcaaatatgcttcgttttggttttagtccctg |
20661256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 38170511 - 38170569
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38170511 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
38170569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 40764783 - 40764721
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40764783 |
aaaggctaaaatatggttttgctccctgcaaatatgcctcgttttggttttagtccctgcaaa |
40764721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 4736544 - 4736487
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
4736544 |
aaggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
4736487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 19565465 - 19565526
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19565465 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
19565526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 19685382 - 19685325
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19685382 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
19685325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 20986091 - 20986030
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
20986091 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaa |
20986030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 24443378 - 24443439
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
24443378 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaa |
24443439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 35167167 - 35167106
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35167167 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
35167106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 38786157 - 38786214
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38786157 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
38786214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 5917125 - 5917185
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5917125 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
5917185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 9179592 - 9179648
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9179592 |
aggctaaaatatggttttagtccttgcaaatatgattcgttttggttttagtccctg |
9179648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 802 - 862
Target Start/End: Original strand, 18633594 - 18633654
Alignment:
| Q |
802 |
tgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
18633594 |
tgaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
18633654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 19685016 - 19685076
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19685016 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
19685076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 810 - 866
Target Start/End: Original strand, 20985728 - 20985784
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20985728 |
taaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
20985784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 24443745 - 24443689
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
24443745 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24443689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 35609303 - 35609358
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35609303 |
ggctaaaatatggttttggtccatgcaaatatgcatcgttttggttttagtccctg |
35609358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 803 - 862
Target Start/End: Complemental strand, 36578087 - 36578028
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36578087 |
gaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
36578028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 1381244 - 1381302
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
1381244 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
1381302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 2217491 - 2217549
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2217491 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2217549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 7075569 - 7075627
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7075569 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7075627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 9179923 - 9179865
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
9179923 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttattccctg |
9179865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 20660946 - 20661000
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
20660946 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
20661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 28863507 - 28863565
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28863507 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 37271709 - 37271647
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
37271709 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctgcaaa |
37271647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 18258160 - 18258221
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
18258160 |
aaggctaaaatatggttttggtccctgcaaatatggctcattttggttttagtccctgcaaa |
18258221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 29172888 - 29172831
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29172888 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 38496784 - 38496727
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
38496784 |
aaggctaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
38496727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 39379611 - 39379558
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
39379611 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
39379558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 1104857 - 1104913
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
1104857 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctg |
1104913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 5904007 - 5904063
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
5904007 |
aggctaaaatatggttttgctccttgcaaatatgcctcgttttgattttagtccctg |
5904063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 5950175 - 5950231
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
5950175 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
5950231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 10744055 - 10743999
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10744055 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
10743999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 11799459 - 11799403
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11799459 |
aggctaaaatatggttttagtccgtgcaaatatgcctcgttttggttttagtccctg |
11799403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 803 - 859
Target Start/End: Complemental strand, 18258531 - 18258475
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
18258531 |
gaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
18258475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 29692743 - 29692799
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29692743 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29692799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 29875726 - 29875670
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29875726 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29875670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 30800493 - 30800549
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30800493 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 30800851 - 30800795
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30800851 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
30800795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 37271358 - 37271414
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
37271358 |
aggctaaaatatggttttggtctctgcaaatatgcctcgttttggttttagtccctg |
37271414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 45138 - 45193
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
45138 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
45193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 2217855 - 2217800
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
2217855 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
2217800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 808 - 859
Target Start/End: Complemental strand, 2636992 - 2636941
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
2636992 |
gctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtcc |
2636941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 9532538 - 9532483
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
9532538 |
aaaggttaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtcc |
9532483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 10743721 - 10743776
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
10743721 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
10743776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 16038374 - 16038429
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
16038374 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
16038429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 25561705 - 25561760
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25561705 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
25561760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 28550827 - 28550882
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28550827 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28550882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 28863838 - 28863783
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
28863838 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
28863783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 30888160 - 30888215
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
30888160 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
30888215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 35928458 - 35928403
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35928458 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35928403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 40029497 - 40029442
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
40029497 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40029442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 797 - 859
Target Start/End: Original strand, 293818 - 293880
Alignment:
| Q |
797 |
aaatttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||| |||||||||||||||||||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
293818 |
aaatttaaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtcc |
293880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 6912860 - 6912802
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
6912860 |
aaagactaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
6912802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 10408925 - 10408983
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
10408925 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
10408983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 863
Target Start/End: Original strand, 11799127 - 11799185
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgc |
863 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| | |||||||||||||||||||| |
|
|
| T |
11799127 |
aaggctaaaatatggttttagtccctgcaaatatgcattgttttggttttagtccctgc |
11799185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 26133416 - 26133358
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26133416 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
26133358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 28213371 - 28213425
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || ||||||||||||||| |
|
|
| T |
28213371 |
aaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtcc |
28213425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 29172524 - 29172578
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29172524 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
29172578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 29693092 - 29693038
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
29693092 |
aaggctaaaatatgattttagtccctgcaaatatgcttcgttttggttttagtcc |
29693038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 40167783 - 40167841
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
40167783 |
aaaggctaaagtatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
40167841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 14318044 - 14318097
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
14318044 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtcc |
14318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 15635709 - 15635652
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
15635709 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggttttagtccctg |
15635652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 18046349 - 18046296
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
18046349 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
18046296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 28871996 - 28871939
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
28871996 |
aaggctaaattatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
28871939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 45501 - 45445
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
45501 |
taaaatatggttttggtccctgcaaatatgtttcgttttggttttaatctctgcaaa |
45445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 3850600 - 3850540
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3850600 |
aggctgaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
3850540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 805 - 857
Target Start/End: Original strand, 4203454 - 4203506
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
4203454 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
4203506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 5614531 - 5614475
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
5614531 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
5614475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 20690732 - 20690784
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
20690732 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
20690784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 25779163 - 25779107
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
25779163 |
aggctaaaatatggttttagtccctgcaaatatgcttcattttggttttagttcctg |
25779107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 28108159 - 28108107
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
28108159 |
taaaatatggttttggtccctacaaatatgcctcgttttggttttagtccctg |
28108107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 28871640 - 28871692
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
28871640 |
taaaatatgattttggtccctgcaaatatccttcgttttggttttagtccctg |
28871692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 32108807 - 32108863
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |||||| |||||| |
|
|
| T |
32108807 |
aggctaaaatatggttttggtccctgcaaatatgtttcgttttagttttaatccctg |
32108863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35877053 - 35876997
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
35877053 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagcccctg |
35876997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 36577721 - 36577777
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
36577721 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
36577777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 42207241 - 42207297
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
42207241 |
aggctaaaatatggttttagtccttgtaaatatgtctcgttttggttttagtccctg |
42207297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 1286682 - 1286737
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
1286682 |
ggctaaaatatggtgttggtccctacaaatatgcctcgttttggttttagtccctg |
1286737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 2636669 - 2636728
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
2636669 |
ggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtctctgcaaa |
2636728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 6118499 - 6118444
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
6118499 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
6118444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 18633961 - 18633906
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
18633961 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttactccctg |
18633906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 21050913 - 21050858
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
21050913 |
ggctaaaatatggttttagtccctgcaaatatgcatcgttttgattttagtccctg |
21050858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 26133183 - 26133238
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
26133183 |
ggctaaaatatggttttagtccctacaaatatgcctcgttttggttttagtccctg |
26133238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 33336026 - 33335971
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33336026 |
ggctaaaatatggttttagtccctgcaaatatgactcgttttggttttagtccctg |
33335971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 735 - 805
Target Start/End: Original strand, 41732218 - 41732289
Alignment:
| Q |
735 |
tggcttttaataaaatatttttctaacataatatttaa-ataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||| ||||| || |||||||||||||||||||||| | |||||||||||||| |||||| ||||||||||| |
|
|
| T |
41732218 |
tggcctttaaaaatatatttttctaacataatattttatataaaatcaattttatggagatcaaaatttgaa |
41732289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 13990897 - 13990843
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
13990897 |
aaggctaaaatacggttttagtccctgcaaatatgcctcgttttggttttagtcc |
13990843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 18046035 - 18046093
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
18046035 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
18046093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 21124910 - 21124968
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
21124910 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
21124968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 29855614 - 29855668
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| || |||||||||||||||||| |
|
|
| T |
29855614 |
gctaaaatatgattttggtccttggaaatatgcctcattttggttttagtccctg |
29855668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 35166909 - 35166971
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta-gtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
35166909 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttaggtccctgcaaa |
35166971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 20683745 - 20683802
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
20683745 |
aaggctaaaatatggttttagtctctgcaaatatgcatcgttttgattttagtccctg |
20683802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 855
Target Start/End: Complemental strand, 25562000 - 25561951
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
25562000 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttta |
25561951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 29151853 - 29151796
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||| |||||||||||||||| |||| |
|
|
| T |
29151853 |
aaggctaaaatatggttttagttcctgcaaatatgcctcgttttggttttagttcctg |
29151796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 29875398 - 29875455
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29875398 |
aaggctaaaatatgattttaatccctgcaaatatgcctcgttttggttttagtccctg |
29875455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 34125306 - 34125359
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| ||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
34125306 |
aggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtcc |
34125359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 34125634 - 34125577
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| || |||||||| || |||||||||||||||||| |
|
|
| T |
34125634 |
aaggctaaaatatggttttagtccctgtaaatatgcctcattttggttttagtccctg |
34125577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 4203771 - 4203715
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
4203771 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
4203715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 10409327 - 10409275
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||| |||||||| |
|
|
| T |
10409327 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtc |
10409275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 12144906 - 12144962
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| || |||||||||||||||||| |
|
|
| T |
12144906 |
aggctaaaatatggtttttgtccctgtaaatatgcctctttttggttttagtccctg |
12144962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 23382297 - 23382245
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| | |||||||||||||||| |
|
|
| T |
23382297 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
23382245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 24781988 - 24782044
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
24781988 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24782044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 809 - 857
Target Start/End: Complemental strand, 35609635 - 35609587
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
35609635 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
35609587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 39379242 - 39379294
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
39379242 |
taaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
39379294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 40168009 - 40167953
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
40168009 |
aggctaaaatattgttttagtccatgcaaatatgtctcgttttggttttagtccctg |
40167953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 42596814 - 42596762
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
42596814 |
taaaatatggttttggtccctgcaaatatgactcgttttagttttagtccctg |
42596762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 5614163 - 5614218
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||| ||||||||| |
|
|
| T |
5614163 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
5614218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 21050575 - 21050630
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| | |||||||||||||||||| |||||||||||| |
|
|
| T |
21050575 |
ggctaaaatatgattttagtccctacaaatatgcttcgttttgattttagtccctg |
21050630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 29151516 - 29151571
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
29151516 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttgattttagtccctg |
29151571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 29366949 - 29366894
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
29366949 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
29366894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 811 - 862
Target Start/End: Original strand, 32888691 - 32888742
Alignment:
| Q |
811 |
aaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||||||| | ||||||| ||||||||||||| |
|
|
| T |
32888691 |
aaaatatggttttggtccctgcaaatattcctcgttttcgttttagtccctg |
32888742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 36973710 - 36973655
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| |||||||| |||||||||||| |
|
|
| T |
36973710 |
ggctaaaatatggttttggtccctggaaatatgtctcgttttgattttagtccctg |
36973655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 38555084 - 38555030
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
38555084 |
aggctaaaatatggttt-ggtccctgcaaatatgcctcattttggttttagtccct |
38555030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 40038858 - 40038803
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| | |||||||||||| |||||| |
|
|
| T |
40038858 |
ggctaaaatatgattttggtccctgcaaatatgccttgttttggttttaatccctg |
40038803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 858
Target Start/End: Original strand, 42553642 - 42553693
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
42553642 |
ggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtc |
42553693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 861
Target Start/End: Original strand, 15916286 - 15916340
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
15916286 |
ggctaaaagatggttttggtccctgcaaatatgtctcattttggttttagtccct |
15916340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 17070532 - 17070589
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||| |||| |||||||||||| |
|
|
| T |
17070532 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcg-tttgattttagtccctg |
17070589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 26071619 - 26071561
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| ||||||||| ||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
26071619 |
aaaggttaaaatatgattttgatccctgcaaatatgtctcgttttggttttagtccctg |
26071561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 858
Target Start/End: Complemental strand, 27916767 - 27916713
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
27916767 |
aaaggttaaaatatggttttattccctgcaaatatgcctcgttttggttttagtc |
27916713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 851
Target Start/End: Original strand, 4736204 - 4736249
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggt |
851 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
4736204 |
aggctaaaatatggttttggtctttgcaaatatgtctcgttttggt |
4736249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 15635374 - 15635431
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
15635374 |
aaggataaaatatggttttagtccatgcaaatatgtcttgttttggttttagtccctg |
15635431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 858
Target Start/End: Complemental strand, 16038738 - 16038689
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
16038738 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtc |
16038689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 855
Target Start/End: Complemental strand, 31037742 - 31037693
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
31037742 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
31037693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 36278080 - 36278133
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||| |||| |||||||||| |
|
|
| T |
36278080 |
aggctaaaatatggttttgatccctgcaaatatgtttcattttagttttagtcc |
36278133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 764 - 805
Target Start/End: Original strand, 37941229 - 37941270
Alignment:
| Q |
764 |
aatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
37941229 |
aatatttatataaaatcaattttgttgagaccaaaatttgaa |
37941270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 40029139 - 40029196
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| || ||||||| |||||||||||||| |||||| |
|
|
| T |
40029139 |
aaggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttaatccctg |
40029196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 855
Target Start/End: Original strand, 40038493 - 40038542
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||| ||||| |
|
|
| T |
40038493 |
aggctaaaatatggttttgatccctgcaaatatgcctcgttttgatttta |
40038542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 42207570 - 42207518
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
42207570 |
ctaaaatatggttttagtccta-caaatatgcctcgttttggttttagtccctg |
42207518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 2032940 - 2032888
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
2032940 |
ggctaaattatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
2032888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 3850299 - 3850355
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttgg-ttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
3850299 |
ggctaaaatatggttttagtccctgcaaatctgcctcgttttggtttttagtccctg |
3850355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 10830528 - 10830584
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| | |||||||||||||| |||| |
|
|
| T |
10830528 |
aggctaaaatatggttttggtctcttcaaatatgcctagttttggttttagttcctg |
10830584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 805 - 857
Target Start/End: Complemental strand, 18286743 - 18286691
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||| |||||||| |||| ||||||||| | |||||||||||||||| |
|
|
| T |
18286743 |
aaggctaaaaaatggttttagtccctgcaaatatacctcgttttggttttagt |
18286691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 23381949 - 23382005
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| | |||||||||||||| |||| |
|
|
| T |
23381949 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
23382005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 26071290 - 26071346
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| ||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
26071290 |
aggctaaaatatagtttcggtccctgcaaatatgtctcattttggttttagtccctg |
26071346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 746 - 805
Target Start/End: Complemental strand, 28440933 - 28440873
Alignment:
| Q |
746 |
aaaatatt-tttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| ||| ||||| |||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
28440933 |
aaaatattgtttttaacagaatatttatataaaatcaattttgtggagattaaaatttgaa |
28440873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 32109097 - 32109042
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||| ||||| |||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
32109097 |
aggctaatatatgattttggtcgt-gcaaatatgtttcgttttggttttagtccctg |
32109042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35166159 - 35166103
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||| ||||||||||| |||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
35166159 |
aggctataatatggttttagtccctgcaaaaatgtctcgttttggttttagtccctg |
35166103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 805 - 860
Target Start/End: Original strand, 20416358 - 20416413
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||| |||||||| |||||| |
|
|
| T |
20416358 |
aaggctaaaatatggttttcgtccctgcaaatatgtctcgctttggtttaagtccc |
20416413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 804 - 855
Target Start/End: Complemental strand, 38452399 - 38452348
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
38452399 |
aaagcctaaaatatggttttggtccctgcaaatatgtctcgttttgatttta |
38452348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 857
Target Start/End: Complemental strand, 5104001 - 5103951
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| || ||||||||||||| |
|
|
| T |
5104001 |
ggctaaaatatggttttggttcctgcaaatatgtctcattttggttttagt |
5103951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 27916462 - 27916516
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| | || || | |||||||||| |||||||||||||||||||||| |
|
|
| T |
27916462 |
gctaaaatatgatcttagttcctgcaaatatgtttcgttttggttttagtccctg |
27916516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 806 - 852
Target Start/End: Original strand, 31602142 - 31602188
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtt |
852 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
31602142 |
aggctaaaatatagttttgatccctgcaaatatgcatcgttttggtt |
31602188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 857
Target Start/End: Original strand, 36973353 - 36973403
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
36973353 |
ggctaaaatatggttttggtctctccaaatatgtctcgttttggttttagt |
36973403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 857
Target Start/End: Original strand, 38962806 - 38962856
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||| |||| || ||||||| |||||||||||||||| |
|
|
| T |
38962806 |
ggctaaaatatggttttagtccctgtaaatatgtctcgttttggttttagt |
38962856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 1287047 - 1286990
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||| || ||||||| || ||||||||||||| |||| |
|
|
| T |
1287047 |
aaggttaaaatatggttttggtccctgtaaatatgtctcattttggttttagttcctg |
1286990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 854
Target Start/End: Complemental strand, 12145181 - 12145136
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||| |
|
|
| T |
12145181 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttgatttt |
12145136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 858
Target Start/End: Original strand, 16616370 - 16616419
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| || |||| ||||||||| |
|
|
| T |
16616370 |
ctaaaatatggttttagtccctgcaaatatgcctcattttagttttagtc |
16616419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 858
Target Start/End: Complemental strand, 20691094 - 20691045
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||| ||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
20691094 |
ctaaaatatgattttggttcctgcaaatatggctcgttttggttttagtc |
20691045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 804 - 861
Target Start/End: Complemental strand, 27850377 - 27850320
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||| |||||||||| |||| ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
27850377 |
aaagactaaaatatgattttagtctctgcaaatatgtctcgttttggttttagtccct |
27850320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 804 - 853
Target Start/End: Complemental strand, 38182090 - 38182041
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttt |
853 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
38182090 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38182041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 804 - 853
Target Start/End: Original strand, 38189041 - 38189090
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttt |
853 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
38189041 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38189090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 804 - 853
Target Start/End: Complemental strand, 38209316 - 38209267
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttt |
853 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
38209316 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38209267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 804 - 853
Target Start/End: Original strand, 38216266 - 38216315
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttt |
853 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
38216266 |
aaaggctaaaatatggttttggtttctgcaaatatgtctcgttttggttt |
38216315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 38554750 - 38554800
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
38554750 |
aggctaaaatatggttttgatccctgcaaatat--ctcgttttggttttagtc |
38554800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 4e-22; HSPs: 202)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 29499179 - 29499241
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29499179 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
29499241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 30046795 - 30046733
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30046795 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
30046733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 30061136 - 30061074
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30061136 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
30061074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 4e-22
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 31560328 - 31560390
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31560328 |
aaaggctaaaatatggttttgatccctgcaaatatgcttcgttttggttttagtccctgcaaa |
31560390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 799 - 862
Target Start/End: Complemental strand, 13530721 - 13530658
Alignment:
| Q |
799 |
atttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13530721 |
attttaaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13530658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 23245231 - 23245290
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
23245231 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
23245290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 35464382 - 35464323
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
35464382 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
35464323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 52; E-Value: 3e-20
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 42848391 - 42848332
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42848391 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
42848332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 24774042 - 24774100
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
24774042 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
24774100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 35119289 - 35119347
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
35119289 |
aaaggctaaaatatggttttggtccctgcaaatatgctccgttttggttttagtccctg |
35119347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 43231085 - 43231147
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43231085 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
43231147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 43231392 - 43231334
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
43231392 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
43231334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 13631601 - 13631540
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13631601 |
aaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctgcaaa |
13631540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 29499548 - 29499487
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29499548 |
aaggttaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
29499487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 55072387 - 55072444
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
55072387 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
55072444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 798 - 862
Target Start/End: Complemental strand, 16712700 - 16712636
Alignment:
| Q |
798 |
aatttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
16712700 |
aattcgaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
16712636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 47023106 - 47023046
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47023106 |
aggctaaaatatggttttgatccctgcaaatatgtttcgttttggttttagtccctgcaaa |
47023046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 53915682 - 53915742
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
53915682 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaa |
53915742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 19321859 - 19321804
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
19321859 |
ggctaaaatatggttttggtccctgcaaatatgtttcgttttggttttagtccctg |
19321804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 26412584 - 26412525
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26412584 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaa |
26412525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 46115414 - 46115469
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
46115414 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46115469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 46128548 - 46128603
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
46128548 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
46128603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 5827976 - 5827918
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5827976 |
aaaggctaaaatatggttttggtccctgcaaatatgactcgttttggttttagtccctg |
5827918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 8760784 - 8760726
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8760784 |
aaaggctaaaatatggttttagtccttgcaaatatggctcgttttggttttagtccctg |
8760726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 13064468 - 13064410
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13064468 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
13064410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 14791809 - 14791751
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
14791809 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
14791751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 25424315 - 25424257
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
25424315 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25424257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 28809183 - 28809121
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
28809183 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctccaaa |
28809121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 6827544 - 6827597
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
6827544 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtc |
6827597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 25423922 - 25423979
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
25423922 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
25423979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 41345851 - 41345908
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41345851 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41345908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 52017503 - 52017560
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
52017503 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 52017872 - 52017815
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
52017872 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
52017815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 52442094 - 52442037
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52442094 |
aaggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtccctg |
52442037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 54903477 - 54903420
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
54903477 |
aaggctaaaatatggttttggtccctgcaaatatgccccgttttggttttagtccctg |
54903420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 4211560 - 4211616
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
4211560 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
4211616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 13631227 - 13631283
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13631227 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13631283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 14487801 - 14487857
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
14487801 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctg |
14487857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 18205154 - 18205210
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
18205154 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
18205210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 32208540 - 32208596
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
32208540 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
32208596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 35464017 - 35464073
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
35464017 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
35464073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 35763646 - 35763702
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35763646 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35763702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 807 - 863
Target Start/End: Original strand, 46292392 - 46292448
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgc |
863 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
46292392 |
ggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttggtccctgc |
46292448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 47022738 - 47022794
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47022738 |
aaggataaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccct |
47022794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 53916048 - 53915988
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||||| |
|
|
| T |
53916048 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagttcctgcaaa |
53915988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 13073759 - 13073814
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13073759 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
13073814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 865
Target Start/End: Original strand, 26412189 - 26412248
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
26412189 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctgcaa |
26412248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 28809011 - 28809066
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28809011 |
ggctaaaatatggttttagtccttgcaaatatgtatcgttttggttttagtccctg |
28809066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 29420538 - 29420483
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
29420538 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccct |
29420483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 810 - 865
Target Start/End: Original strand, 30060772 - 30060827
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
30060772 |
taaaatatggttttggtccctgcaaatatgcctcgttttgtttttagtccctgcaa |
30060827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 35415633 - 35415578
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
35415633 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
35415578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 803 - 862
Target Start/End: Complemental strand, 45505898 - 45505839
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
45505898 |
gaaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
45505839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 53717174 - 53717119
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
53717174 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
53717119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 2034858 - 2034800
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
2034858 |
aaaggctaaaatatggttttagtcccagcaaatatgcctcgttttggttttagtccctg |
2034800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 6353637 - 6353583
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
6353637 |
gctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtccctg |
6353583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 731 - 805
Target Start/End: Original strand, 9363210 - 9363283
Alignment:
| Q |
731 |
aatgtggcttttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||||||||| || || ||||| ||||| |||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
9363210 |
aatgtggcttttaaaaatattttttt-taacagaatatttatataaaatcaattttgtggagatcaaaatttgaa |
9363283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 13764809 - 13764755
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||| ||||||||||||||||||| |
|
|
| T |
13764809 |
aaggctaaaatatggttttggtccctgtaaatatgtttcgttttggttttagtcc |
13764755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 29463916 - 29463858
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
29463916 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttggtccctg |
29463858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 38054543 - 38054601
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
38054543 |
aaaggttaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
38054601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 42848024 - 42848082
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
42848024 |
aaaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
42848082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 43368462 - 43368520
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
43368462 |
aaagactaaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
43368520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 46115782 - 46115720
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
46115782 |
aaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaa |
46115720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 46128916 - 46128854
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
46128916 |
aaaggctaaaatatggttttagtccctgcaaatacgtctcgttttggttttagtccctgcaaa |
46128854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 855
Target Start/End: Original strand, 52543420 - 52543470
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
52543420 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggtttta |
52543470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 2180218 - 2180275
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
2180218 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
2180275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 6827876 - 6827819
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
6827876 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
6827819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 13074126 - 13074073
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
13074126 |
aggctaaaatatggttttggtccctgcaaatatacctcgttttggttttagtcc |
13074073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 31811923 - 31811980
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
31811923 |
aaggctaaaatatggttttgatccctgcaaatatgtatcgttttggttttagtccctg |
31811980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 31812215 - 31812158
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
31812215 |
aaggctaaaatatggttttggttcctgcaaatatgtctcgttttggttttagtccctg |
31812158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 32365485 - 32365428
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
32365485 |
aaggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtccctg |
32365428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 35420393 - 35420446
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
35420393 |
ctaaaatatggttttggtccccgcaaatatgctttgttttggttttagtccctg |
35420446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 35420701 - 35420648
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
35420701 |
ctaaaatatggttttggtccttgcaaatatgtctcgatttggttttagtccctg |
35420648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 36054152 - 36054095
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
36054152 |
aaggctaaaatacggttttggtccctgcaaatatgcctcattttggttttagtccctg |
36054095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 41620258 - 41620201
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
41620258 |
aaggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
41620201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 45474598 - 45474545
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
45474598 |
aaggctaaaatatggttttagtccctgcaaatatgcttcgctttggttttagtc |
45474545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 45505598 - 45505655
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
45505598 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
45505655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 51762868 - 51762925
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
51762868 |
aaggctaaaatatggtattggtctctgcaaatatgcttcattttggttttagtccctg |
51762925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 123533 - 123589
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
123533 |
aggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
123589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 5882551 - 5882606
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5882551 |
aggctaaaatatggttttagtcct-gcaaatatgcctcgttttggttttagtccctg |
5882606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 9289265 - 9289321
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9289265 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 11693122 - 11693066
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
11693122 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttgattttagtccctg |
11693066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 12152494 - 12152438
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
12152494 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttggtccctg |
12152438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 12791975 - 12791919
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12791975 |
aggctaaaatatgatttttgtccctgcaaatatgcctcgttttggttttagtccctg |
12791919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 13064158 - 13064214
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
13064158 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
13064214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 13479612 - 13479556
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13479612 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
13479556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 13530378 - 13530438
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
13530378 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttgattttagtccctgcaaa |
13530438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 14488188 - 14488132
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
14488188 |
aggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
14488132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 15555506 - 15555558
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15555506 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15555558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 19321569 - 19321629
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||| ||||||||| || ||| |||| ||||||||||||||||||||||||| |
|
|
| T |
19321569 |
aggctaaaatatgattttggtccctgtaaacatgcctcgttttggttttagtccctgcaaa |
19321629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 20291985 - 20292037
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
20291985 |
aggctaaaatatgattttggtccctgcaaatatgcctcgttttggttttagtc |
20292037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 22099543 - 22099595
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
22099543 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
22099595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 22584286 - 22584338
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
22584286 |
aggctaaaatatggttttagtccttgcaaatatgtctcgttttggttttagtc |
22584338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 22584608 - 22584552
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
22584608 |
aggctaaaatgtggttttagtctctgcaaatatgcttcgttttggttttagtccctg |
22584552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 23245596 - 23245540
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
23245596 |
aggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtccctg |
23245540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 805 - 857
Target Start/End: Original strand, 23778962 - 23779014
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
23778962 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagt |
23779014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 24474965 - 24474909
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||||||| |
|
|
| T |
24474965 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccct |
24474909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 28448833 - 28448885
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28448833 |
aggctaaaatatggttttagtccttacaaatatgcctcgttttggttttagtc |
28448885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 32365093 - 32365149
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
32365093 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagttcctg |
32365149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 35415298 - 35415354
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
35415298 |
aggctaaaatatggttttagtccctgtaaatatgcatcgttttggttttagtccctg |
35415354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 41619902 - 41619954
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41619902 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
41619954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 46088061 - 46088005
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
46088061 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
46088005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 51545966 - 51545914
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
51545966 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
51545914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 51738412 - 51738356
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| |||| ||||||| |
|
|
| T |
51738412 |
aggctaaaatatggttttggtccatgcaaatatgcctcgttttgattttggtccctg |
51738356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 5052587 - 5052532
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
5052587 |
aaaggctacaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
5052532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 5827655 - 5827710
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
5827655 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
5827710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 855
Target Start/End: Original strand, 8904883 - 8904934
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
8904883 |
aaaggctaaaatatagttttggtccctgcaaatatgcctcgttttggtttta |
8904934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 13764613 - 13764668
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| |||||||| |
|
|
| T |
13764613 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggtttaagtccctg |
13764668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 25358540 - 25358481
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
25358540 |
ggctaaaatatgattttggtccctgtaaatatgtctcgttttggttttagtccctgcaaa |
25358481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 26313988 - 26314043
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
26313988 |
ggctaaaatatggttttgatccctgcaaatatgttccgttttggttttagtccctg |
26314043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 27008084 - 27008139
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27008084 |
ggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
27008139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 29380913 - 29380858
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
29380913 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
29380858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 31560695 - 31560640
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || |||||||||||||||||| |
|
|
| T |
31560695 |
ggctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtccctg |
31560640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 41324890 - 41324835
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41324890 |
ggctaaaatatggttttgatctctgcaaatatgcctcgttttggttttagtccctg |
41324835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 50714240 - 50714295
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
50714240 |
ggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
50714295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 50714565 - 50714510
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
50714565 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
50714510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 53308068 - 53308013
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
53308068 |
ggctaaaatatggttttggtccctgcaaatatgtcccgttttggttttagtccctg |
53308013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 55805088 - 55805029
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| | |||||||||||||||| |||||| |
|
|
| T |
55805088 |
ggctaaaatatagttttggttcttgcaaatatgccttgttttggttttagtccatgcaaa |
55805029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 812 - 862
Target Start/End: Original strand, 2034544 - 2034594
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||| ||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2034544 |
aaatatgattttggtccctgcaaatatgcctcgttttggttttagtccctg |
2034594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 2322094 - 2322148
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||||||||| |||| |
|
|
| T |
2322094 |
gctaaaatatggttttggtccctacaaatatgcctcgttttggttttagtacctg |
2322148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 2322435 - 2322377
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
2322435 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtgcctg |
2322377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 11285504 - 11285558
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
11285504 |
gctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
11285558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 809 - 859
Target Start/End: Complemental strand, 19903653 - 19903603
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
19903653 |
ctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
19903603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 855
Target Start/End: Complemental strand, 20144733 - 20144683
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||| |||||||||||||| |
|
|
| T |
20144733 |
aaggctaaaatatggttttggttcatgcaaatatgcctcgttttggtttta |
20144683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 26314335 - 26314277
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||| ||||||||||||||||||||| |
|
|
| T |
26314335 |
aaaggctaaaatatggttttgatccctgaaaatatgtctcgttttggttttagtccctg |
26314277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 855
Target Start/End: Complemental strand, 28449216 - 28449166
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
28449216 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttgatttta |
28449166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 30564830 - 30564888
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||| |||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
30564830 |
aaagactaaaatatggttttagtccctgcaaatatgttttgttttggttttagtccctg |
30564888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Original strand, 34361801 - 34361855
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
34361801 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
34361855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 36050289 - 36050343
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
36050289 |
gctaaaatatggttttggtccccgcaaatatgtctcgttttggttttagtccctg |
36050343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 37557194 - 37557140
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||| |||||||||||| |
|
|
| T |
37557194 |
gctaaaatatggttttggtccctgcaaatatacctcgttttgattttagtccctg |
37557140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 41921086 - 41921032
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| | || |||||||||| ||||||||||||||||||| |
|
|
| T |
41921086 |
aaggctaaaatatggttttagcccctgcaaatatgtttcgttttggttttagtcc |
41921032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 44925482 - 44925536
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
44925482 |
aaaggctaaaatatggttttgatccctgcaaatatgtctcgttttggttttagtc |
44925536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 44925844 - 44925790
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
44925844 |
gctaaaatatggttttggtctccgcaaatatgcctcgttttggttttagtccctg |
44925790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 858
Target Start/End: Complemental strand, 46292654 - 46292600
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| || |||||||||||||| |
|
|
| T |
46292654 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
46292600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 812 - 862
Target Start/End: Complemental strand, 47532667 - 47532617
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
47532667 |
aaatatggttttggtccttgcaaatatgtctcgttttggttttagttcctg |
47532617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 9445951 - 9446004
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9445951 |
ctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
9446004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 22099914 - 22099861
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
22099914 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtc |
22099861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 24474599 - 24474651
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
| T |
24474599 |
aggctaaaatatggttttagtcct-gcaaatatgcatcgttttggttttagtcc |
24474651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 740 - 805
Target Start/End: Complemental strand, 25505407 - 25505342
Alignment:
| Q |
740 |
tttaataaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||| || |||||||| || |||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
25505407 |
tttaaaaacatatttttaaaaaataatatttatataaaatcaattttgtggagatcaaaatttgaa |
25505342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 27427870 - 27427930
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27427870 |
aaggctaaaatatggtttag-tccctgcaaatatggctcgttttggttttagtccctgcaaa |
27427930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 36701998 - 36702055
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
36701998 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
36702055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 51545627 - 51545680
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| | ||||||||||||||||| |
|
|
| T |
51545627 |
aaggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtc |
51545680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 51709029 - 51708976
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| || |||||||||||||| |
|
|
| T |
51709029 |
aaggctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtc |
51708976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 858
Target Start/End: Complemental strand, 54208827 - 54208774
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
54208827 |
aaggttaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
54208774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 861
Target Start/End: Original strand, 5202929 - 5202981
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcg-ttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5202929 |
taaaatatggttttggtccctgcaaatatgcctcgtttttggttttagtccct |
5202981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 5797817 - 5797761
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||||||| |||||||||| |
|
|
| T |
5797817 |
taaaatatggttttggtccctacaaatatgtctcgttttggttttaatccctgcaaa |
5797761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 9289640 - 9289584
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
9289640 |
aggcttaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
9289584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 12152153 - 12152209
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
12152153 |
aggctaaaatatggttttggtccctgcaaatatgactcgtttaagttttagtccctg |
12152209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 858
Target Start/End: Original strand, 14791502 - 14791550
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
14791502 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
14791550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 20144423 - 20144475
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||| ||||||| ||||| |
|
|
| T |
20144423 |
taaaatatggttttggtccctgcaaatatgcctcgttttagttttagaccctg |
20144475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 805 - 861
Target Start/End: Complemental strand, 32208903 - 32208847
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
32208903 |
aaggctaaaatatggttttaatccctgcaaatatgcctcgttttgattttagtccct |
32208847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35763956 - 35763900
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
35763956 |
aggctaaaatatgattttagtccctgcagatatgcctcgttttggttttagtccctg |
35763900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 37556840 - 37556896
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
37556840 |
aggctaaaatatggttttagaccttgcaaatatacctcgatttggttttagtccctg |
37556896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 42823775 - 42823831
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
42823775 |
aggctaaaatatgattttggtccctgcaaatatgtctcgttttggttttagtacctg |
42823831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 866
Target Start/End: Original strand, 50822013 - 50822069
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||| |||| || ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
50822013 |
taaaatatggttttagtccctgtaaatatgattcattttggttttagtccctgcaaa |
50822069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 858
Target Start/End: Original strand, 51708692 - 51708744
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
51708692 |
aggctaaaatatggttttagtccctgcaaatatggctcgttttggttttagtc |
51708744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 51738136 - 51738192
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| |||||||||||||| |||||| |
|
|
| T |
51738136 |
aggctaaaatatggttttggtccctacaaatatgtctcgttttggttttactccctg |
51738192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 52430101 - 52430045
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
52430101 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttagttttagtccctg |
52430045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 52441762 - 52441818
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
52441762 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtccctg |
52441818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 55072709 - 55072657
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
55072709 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
55072657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 7642652 - 7642597
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| || ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
7642652 |
ggctaaaatatgattatggtctctgcaaatatgtttcgttttggttttagtccctg |
7642597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 8191391 - 8191336
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||| ||||| |||||||| |
|
|
| T |
8191391 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
8191336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 11692761 - 11692816
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
11692761 |
aggctaaaatgtggttttggtccctgcaaatatgccccgttttgattttagtccct |
11692816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 808 - 859
Target Start/End: Complemental strand, 47136170 - 47136119
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||||||||||||| |
|
|
| T |
47136170 |
gctaaaatatggttttggtccctgcaaatatgtctcattttggttttagtcc |
47136119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 855
Target Start/End: Complemental strand, 52543730 - 52543679
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||| |||||||||| ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
52543730 |
aaagcctaaaatatgattttggttcttgcaaatatgcctcgttttggtttta |
52543679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 55482468 - 55482413
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
55482468 |
ggctaaaatatgattttagtccctccaaatatgcctcgttttggttttagtccctg |
55482413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 846
Target Start/End: Original strand, 9836829 - 9836871
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgtt |
846 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
9836829 |
aaaggctaaaatatggttttgatccttgcaaatatgtttcgtt |
9836871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 812 - 862
Target Start/End: Complemental strand, 27008401 - 27008351
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
27008401 |
aaatatggttttagtctctgcaaatatgcctcgttttggttttagtccctg |
27008351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 29380665 - 29380723
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||| |||| |||||||||| ||||||||||||| ||||||| |
|
|
| T |
29380665 |
aaaggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttggtccctg |
29380723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 36702362 - 36702308
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| || | |||| |||||| ||||||||||||||||||||| |
|
|
| T |
36702362 |
gctaaaatatggttttagttcctgcagatatgcctcgttttggttttagtccctg |
36702308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 51763201 - 51763147
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| || ||||||||||||| |||| |
|
|
| T |
51763201 |
gctaaaatatagttttggtccctgcaaatatgcctcattttggttttagttcctg |
51763147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 8760602 - 8760659
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
8760602 |
aaggctaaaatatagttttactccctgcaaatatgtctcgttttggttttagtccctg |
8760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 808 - 861
Target Start/End: Original strand, 13479273 - 13479326
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
13479273 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccct |
13479326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 14594205 - 14594258
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
14594205 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
14594258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 810 - 859
Target Start/End: Original strand, 18135793 - 18135841
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
18135793 |
taaaatatggttttagtcct-gtaaatatgcttcgttttggttttagtcc |
18135841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 18205521 - 18205468
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
18205521 |
ctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagttcctg |
18205468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 23779227 - 23779170
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| || |||||||||||||||||| |
|
|
| T |
23779227 |
aaggctaaaatatggttttaatccctgcaaatatgtctcattttggttttagtccctg |
23779170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 764 - 805
Target Start/End: Complemental strand, 30563754 - 30563713
Alignment:
| Q |
764 |
aatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
30563754 |
aatatttatataaaatcaattttgtggagaccaaaatctgaa |
30563713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 35119612 - 35119559
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
35119612 |
aggctaaaatatggttttggtcactgcaaatatgtctcgttttggtttcagtcc |
35119559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 41346219 - 41346166
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| || ||||||||||||||| |
|
|
| T |
41346219 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtcc |
41346166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 810 - 859
Target Start/End: Original strand, 49123000 - 49123048
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
49123000 |
taaaatatggttttagtcct-gtaaatatgcttcgttttggttttagtcc |
49123048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 53716920 - 53716973
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| | |||||||||||||||| |
|
|
| T |
53716920 |
aggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
53716973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 812 - 860
Target Start/End: Complemental strand, 123893 - 123845
Alignment:
| Q |
812 |
aaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||| |||| ||||||||||| || |||||||||||||||| |
|
|
| T |
123893 |
aaatatggttttagtccctgcaaatatgcctcattttggttttagtccc |
123845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 4279021 - 4279077
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| | || ||||||||| ||||||||||||||||||||| |
|
|
| T |
4279021 |
aggctaaaatatggttttagcccctgcaaatatatctcgttttggttttagtccctg |
4279077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 4279335 - 4279283
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| |||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
4279335 |
ggctaaaatatgattttagtccctgcaaatatggctcgttttggttttagtcc |
4279283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 5797484 - 5797536
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
5797484 |
taaaatatgattttggtctctgcaaatatgtctcgttttggttttagtccctg |
5797536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 802 - 862
Target Start/End: Complemental strand, 31182509 - 31182449
Alignment:
| Q |
802 |
tgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| | | |||||||||| |||||||||||| |||||||| |
|
|
| T |
31182509 |
tgaaaggctaaaatatggttttaattcctgcaaatatgtctcgttttggtttcagtccctg |
31182449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 34355284 - 34355228
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||| ||||||||||||||||||||| |
|
|
| T |
34355284 |
aggctaaaatatggttttagtccctcaaaatatgactcgttttggttttagtccctg |
34355228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 42824091 - 42824039
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| | |||||| ||||||||| |
|
|
| T |
42824091 |
ggctaaaatatggttttggtccctgcaaatatgtcttgttttgattttagtcc |
42824039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 45593227 - 45593283
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||| |||| | ||||||||| ||||||||| ||||||||||| |
|
|
| T |
45593227 |
aggctaaaatatagttttagtccctacaaatatgcctcgttttggctttagtccctg |
45593283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 45593587 - 45593531
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
45593587 |
aggctaaaatatggttttagtctctgcaaatatgtctcgttttggttttagttcctg |
45593531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 859
Target Start/End: Original strand, 25358213 - 25358264
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
25358213 |
gctaaaatatgattttaatccatgcaaatatgcttcgttttggtttcagtcc |
25358264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 8905234 - 8905180
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| || ||||| ||||| ||||| |
|
|
| T |
8905234 |
ggctaaaatatggttttggtccctgtaaatatgcctcattttgattttaatccct |
8905180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 14488114 - 14488072
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||| ||||||| |
|
|
| T |
14488114 |
ttttggtccctgcaaatatgcttcattttggttttggtccctg |
14488072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 858
Target Start/End: Complemental strand, 15555637 - 15555587
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||| ||||||||||||||||| |
|
|
| T |
15555637 |
gctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagtc |
15555587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 18136116 - 18136058
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||| ||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
18136116 |
aaaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
18136058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 36050359 - 36050401
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
36050359 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
36050401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 49123324 - 49123266
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||| ||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
49123324 |
aaaggctaaaatatgactttaatccctacaaatatgcctcgttttggttttagtccctg |
49123266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 858
Target Start/End: Original strand, 16712331 - 16712380
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||| ||| ||||||||||| |||||||||| |||||| |
|
|
| T |
16712331 |
ctaaaatatggttttaatccctgcaaatatgcctcgttttggtattagtc |
16712380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 18831176 - 18831123
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| || ||||||| | ||||||||||||||||||| |
|
|
| T |
18831176 |
ctaaaatatggttttagtccctgtaaatatgtcttgttttggttttagtccctg |
18831123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 839
Target Start/End: Complemental strand, 30091115 - 30091082
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatg |
839 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
30091115 |
aggctaaaatatggttttggtccatgcaaatatg |
30091082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 764 - 805
Target Start/End: Original strand, 36193318 - 36193359
Alignment:
| Q |
764 |
aatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
|||||||| || |||||||||||||||||| ||||||||||| |
|
|
| T |
36193318 |
aatatttatatgaaatcaattttgtggagatcaaaatttgaa |
36193359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 50753920 - 50753977
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| | |||||||||||||| |||| |
|
|
| T |
50753920 |
aaggttaaaatatggttttggtccctgcaaatatatcttgttttggttttagttcctg |
50753977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 53; Significance: 7e-21; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 75765 - 75705
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
75765 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
75705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 75358 - 75414
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
75358 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
75414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 7e-21; HSPs: 132)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 1007123 - 1007179
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1007123 |
aggctaaaatatggttttggtccctgcaaatatgcttcgttttggttttagtccctg |
1007179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 21994404 - 21994344
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21994404 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
21994344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 7e-21
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 22543353 - 22543413
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22543353 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
22543413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 806 - 864
Target Start/End: Original strand, 15962026 - 15962084
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgca |
864 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15962026 |
aggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctgca |
15962084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 21385248 - 21385310
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
21385248 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
21385310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 21385587 - 21385525
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
21385587 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcattttggttttagtccctgcaaa |
21385525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 3968643 - 3968704
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3968643 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
3968704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 866
Target Start/End: Complemental strand, 6412581 - 6412520
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
6412581 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttgattttagtccctgcaaa |
6412520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 14656262 - 14656205
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14656262 |
aaggctaaaatatggttttggtccttgcaaatatgtctcgttttggttttagtccctg |
14656205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 1007510 - 1007454
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1007510 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
1007454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 3414386 - 3414442
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3414386 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3414442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 3969010 - 3968954
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3969010 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
3968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Original strand, 6412217 - 6412277
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6412217 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
6412277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 14655378 - 14655434
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14655378 |
aggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
14655434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 20467719 - 20467659
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
20467719 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctgcaaa |
20467659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 21147403 - 21147459
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
21147403 |
aggctaaaatatggttttggtccctgcaaatatgcatcgttttggttttagtccctg |
21147459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 22543719 - 22543659
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22543719 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
22543659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 25137358 - 25137302
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25137358 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
25137302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 19267565 - 19267620
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
19267565 |
ggctaaaatatggttttggtccctgtaaatatgcttcgttttggttttagtccctg |
19267620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 48; E-Value: 7e-18
Query Start/End: Original strand, 807 - 866
Target Start/End: Original strand, 31198615 - 31198674
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31198615 |
ggctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctgcaaa |
31198674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Complemental strand, 3414755 - 3414693
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||| |
|
|
| T |
3414755 |
aaaggctaaaatatggttttggtccctgtaaatatgtctcgttttggttttagtccctgcaaa |
3414693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 6468307 - 6468365
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
6468307 |
aaaggctaaaatatggttttagtccctgcaaatatgctttgttttggttttagtccctg |
6468365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 14428651 - 14428705
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
14428651 |
gctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
14428705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 809 - 859
Target Start/End: Complemental strand, 14428948 - 14428898
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14428948 |
ctaaaatatggttttagtccttgcaaatatgcttcgttttggttttagtcc |
14428898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 15076207 - 15076149
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15076207 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15076149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 19690390 - 19690448
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
19690390 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
19690448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 866
Target Start/End: Original strand, 20467348 - 20467410
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||| |||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
20467348 |
aaaggataaaatatagttttggtccctgcaaatatgcctcgttttggttttagtccctgcaaa |
20467410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 25136991 - 25137049
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
25136991 |
aaaggctaaaatatggttttggtcgctgcaaatatgcctcgttttggttttagtccctg |
25137049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 33131853 - 33131795
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
33131853 |
aaaggctaaaatatggttttagtctttgcaaatatgcctcgttttggttttagtccctg |
33131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 33801746 - 33801688
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
33801746 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
33801688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 11449171 - 11449114
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
11449171 |
aaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttgtagtccctg |
11449114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 12299142 - 12299085
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
12299142 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagttcctg |
12299085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 24274133 - 24274076
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
24274133 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
24274076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 34990317 - 34990260
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34990317 |
aaggttaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
34990260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 803 - 859
Target Start/End: Original strand, 3356138 - 3356194
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
3356138 |
gaaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtcc |
3356194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 7156161 - 7156105
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7156161 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7156105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 7324189 - 7324137
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7324189 |
taaaatatggttttagtccctgcaaatatgcttcgttttggttttagtccctg |
7324137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 10910965 - 10910909
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
10910965 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
10910909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 13268107 - 13268163
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||| ||||||||||||| |
|
|
| T |
13268107 |
aaggctaaaatatggttttggtccctgcaaatatgcctcgtttaggttttagtccct |
13268163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 17771911 - 17771963
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
17771911 |
ggctaaaatatggttttagtccctgcaaatatgcttcgttttggttttagtcc |
17771963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 18024014 - 18024066
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
18024014 |
taaaatatggttttggtctttgcaaatatgcctcgttttggttttagtccctg |
18024066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 25121497 - 25121441
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
25121497 |
aggctaaaatatggttttggtgcctgcaaatatgtttcgttttggttttagtccctg |
25121441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 15962389 - 15962334
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15962389 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
15962334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 857
Target Start/End: Complemental strand, 19321132 - 19321081
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
19321132 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagt |
19321081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 21995425 - 21995370
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
21995425 |
ggctaaaatatggttttagtccttgcaaatatgcctcgttttggctttagtccctg |
21995370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 34582529 - 34582584
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
34582529 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
34582584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 3276356 - 3276302
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
3276356 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtcc |
3276302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 7155794 - 7155852
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| ||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
7155794 |
aaaggctaaaatatagttttagtccctgcaaatatgcctcgttttggttttagtccctg |
7155852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 8681119 - 8681061
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| | ||||||||||||||||||| |
|
|
| T |
8681119 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtccctg |
8681061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 803 - 857
Target Start/End: Original strand, 17765005 - 17765059
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
17765005 |
gaaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagt |
17765059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 21995061 - 21995119
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
21995061 |
aaaggctaaaatatggttttagtccctgcatatatgcctcgttttggttttagtccctg |
21995119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 22822654 - 22822596
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
22822654 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
22822596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 854
Target Start/End: Original strand, 23502234 - 23502284
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
23502234 |
aaaggctaaaatatggttttggtccctgcaaatatgcctcgttttggtttt |
23502284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 24273825 - 24273883
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
24273825 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagttcctg |
24273883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 30479421 - 30479367
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30479421 |
gctaaaatatggttttggttcatgcaaatatgcctcgttttggttttagtccctg |
30479367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 30928678 - 30928736
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
30928678 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
30928736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 31166871 - 31166925
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
31166871 |
gctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
31166925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 858
Target Start/End: Original strand, 12757608 - 12757661
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
12757608 |
aaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
12757661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 13617531 - 13617584
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
13617531 |
ctaaaatatggttttggtccctgcaaatatggctcgttttggttttagtccctg |
13617584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 797 - 862
Target Start/End: Original strand, 19296098 - 19296163
Alignment:
| Q |
797 |
aaatttgaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||| ||||||||||| |||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
19296098 |
aaattttaaaggctaaaacatggttttagtccctgcaaatatgcgtcgttttgattttagtccctg |
19296163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 318098 - 318042
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
318098 |
aggctaaaatatggttttaatccctgcaaatatgtttcgttttggttttagtccctg |
318042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 494405 - 494457
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
494405 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtcc |
494457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 1890453 - 1890397
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
1890453 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttgattttagtccctg |
1890397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 8170152 - 8170100
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
8170152 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
8170100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 8680774 - 8680830
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8680774 |
aggctaaaatatgtttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8680830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Original strand, 10091039 - 10091091
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
10091039 |
taaaatatggttttagtccctgcaaatatgtttcgttttggttttagtccctg |
10091091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 12419939 - 12419883
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
12419939 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
12419883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 18024376 - 18024320
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
18024376 |
aggctaaaatatggttttggtccctgcaaatatgtcttgttttggttttagtccctg |
18024320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 19129335 - 19129391
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
19129335 |
aggctacaatatggctttggtccctgcaaatatgcctcgttttggttttagtccctg |
19129391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 21993786 - 21993842
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
21993786 |
aggctaaaatatggttttgctccctgcaaatatgtctcgttttggttttagtccctg |
21993842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 804 - 860
Target Start/End: Complemental strand, 22792902 - 22792846
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||||||| | |||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
22792902 |
aaaggctaaaatatggttctagtccctgcaaatatgcctcgttttggttttagtccc |
22792846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 866
Target Start/End: Complemental strand, 24692980 - 24692920
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24692980 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttgcttttagtccctgcaaa |
24692920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 25431855 - 25431799
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
25431855 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
25431799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 26376042 - 26375990
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26376042 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
26375990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 32885672 - 32885728
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
32885672 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtccctg |
32885728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 41; E-Value: 0.0000000000001
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 34582893 - 34582837
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
34582893 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccctg |
34582837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 811 - 862
Target Start/End: Original strand, 543365 - 543416
Alignment:
| Q |
811 |
aaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
543365 |
aaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
543416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 2615871 - 2615926
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| | |||||||||||||||||||| |
|
|
| T |
2615871 |
aggctaaaatatggttttagtccctgcaaatatacctcgttttggttttagtccct |
2615926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 810 - 861
Target Start/End: Complemental strand, 3356495 - 3356444
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
3356495 |
taaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccct |
3356444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 14655903 - 14655958
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14655903 |
ggctaaaacatggttttggtccctgcaaatatatttcgttttggttttagtccctg |
14655958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 19296407 - 19296352
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
19296407 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttaatccctg |
19296352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 858
Target Start/End: Original strand, 24901239 - 24901290
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
24901239 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtc |
24901290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 30929044 - 30928989
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
30929044 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
30928989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 746 - 805
Target Start/End: Complemental strand, 33106123 - 33106064
Alignment:
| Q |
746 |
aaaatatttttctaacataatatttaaataaaatcaattttgtggagaccaaaatttgaa |
805 |
Q |
| |
|
||||||||||| ||| | ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33106123 |
aaaatatttttttaatagaatgtttatataaaatcaattttgtggagaccaaaatttgaa |
33106064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 2373176 - 2373234
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| | ||||||||| ||||||||| |
|
|
| T |
2373176 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttatagtccctg |
2373234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 858
Target Start/End: Original strand, 23628799 - 23628849
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
23628799 |
gctaaaatatggttttggtccctgcaaatatatttcgttttggttttagtc |
23628849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 808 - 862
Target Start/End: Original strand, 23770162 - 23770216
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
23770162 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
23770216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 809 - 862
Target Start/End: Complemental strand, 5286949 - 5286896
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| || |||||||||||||||||| |
|
|
| T |
5286949 |
ctaaaatatggttttagtccctgcaaatatgcctcattttggttttagtccctg |
5286896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 12419707 - 12419760
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12419707 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttggttttagtcc |
12419760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 23502542 - 23502485
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
23502542 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttactccctg |
23502485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 543725 - 543669
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||| |||||||||||| |||||| |
|
|
| T |
543725 |
aggctaaaatatgattttagtccctgcaaatatgctttgttttggttttaatccctg |
543669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 862
Target Start/End: Complemental strand, 12176640 - 12176588
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
12176640 |
taaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
12176588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 12612360 - 12612304
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| || |||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12612360 |
aggctaaaatatggtgttagtccctgcaaatatgcctcgttttagttttagtccctg |
12612304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 15722609 - 15722665
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
15722609 |
aggctaaaatatggttttggtctatgcaaatatgtctcgttttgattttagtccctg |
15722665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 19129521 - 19129465
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
19129521 |
aggctaaaatatgattttggtccctgcaaatatgtcacgttttggttttagtccctg |
19129465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 33808619 - 33808675
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
33808619 |
aggctaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
33808675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 803 - 862
Target Start/End: Original strand, 777673 - 777732
Alignment:
| Q |
803 |
gaaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||| |||| || | ||||||||| | ||||||||||||||||||||| |
|
|
| T |
777673 |
gaaaggctaaaatatgattttagttcctgcaaatatacctcgttttggttttagtccctg |
777732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 1214997 - 1214942
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
1214997 |
aggctaaaatatggttttgatctctgcaaatatgtctcgttttggttttagtccct |
1214942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 10910629 - 10910684
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
10910629 |
ggctaaaatatggttttggtctctacaaatatgtctcgttttggttttagtccctg |
10910684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 805 - 860
Target Start/End: Original strand, 11448535 - 11448590
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccc |
860 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||| ||||||||||||||||||| |
|
|
| T |
11448535 |
aaggctaaaatatgattttagtccctgcaaatatgtctcgttttggttttagtccc |
11448590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 810 - 861
Target Start/End: Original strand, 12298825 - 12298876
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
12298825 |
taaaatatggttttggtccctgcaaatatgtctcgttttcgttttagtccct |
12298876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 819 - 862
Target Start/End: Complemental strand, 13617804 - 13617761
Alignment:
| Q |
819 |
gttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
13617804 |
gttttggtccctgcaaatatgcctcgttttggttttagtccctg |
13617761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 31167200 - 31167145
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
31167200 |
ggctaaaatatggttttagtccctgcaaatatggctcgttttgattttagtccctg |
31167145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 31186591 - 31186536
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| || | ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
31186591 |
ggctaaaatatggtttttgtgcctgcaaatatgcctcgtttttgttttagtccctg |
31186536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 1890056 - 1890114
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||| |||||||||||||| |||| || |||||||| |||||||| |||||||||||| |
|
|
| T |
1890056 |
aaaggttaaaatatggttttagtccctgtaaatatgcctcgttttgattttagtccctg |
1890114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 9896639 - 9896585
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| | |||||||||||||||| |
|
|
| T |
9896639 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtcc |
9896585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 820 - 862
Target Start/End: Complemental strand, 12757864 - 12757822
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
12757864 |
ttttggtccttgcaaatatgcatcgttttggttttggtccctg |
12757822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 857
Target Start/End: Original strand, 15442937 - 15442987
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||| ||||||| |
|
|
| T |
15442937 |
ggctaaaatatggttttggtccctgcaaatatacctcgttttgattttagt |
15442987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 17765378 - 17765320
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||| ||||||| |||||||||||| |
|
|
| T |
17765378 |
aaaggctaaaatatgattttggtccctgcaaatatgtctcgttttatttttagtccctg |
17765320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 854
Target Start/End: Complemental strand, 2616242 - 2616193
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| | ||||||||||| |
|
|
| T |
2616242 |
aaggctaaaatatggttttagtccctgcaaatatgccttgttttggtttt |
2616193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 854
Target Start/End: Original strand, 6591113 - 6591162
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttt |
854 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
6591113 |
aaggctaaaatatggttttagtccccgcaaatatgcctcgttttggtttt |
6591162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 19320769 - 19320822
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || ||||||||||| |||||| |
|
|
| T |
19320769 |
ctaaaatatggttttggtccctgcaaatatgtctcattttggttttaatccctg |
19320822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 804 - 857
Target Start/End: Original strand, 22822304 - 22822357
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| | |||||||||||||||| |
|
|
| T |
22822304 |
aaaggctaaaatatggttttagtctctgcaaatatacctcgttttggttttagt |
22822357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 26375691 - 26375748
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
26375691 |
aaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttaatccctg |
26375748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 317811 - 317867
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
317811 |
aggctaaaatatagttttagtccctgcaaatatgtctcgttttggttttagcccctg |
317867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 805 - 861
Target Start/End: Original strand, 1214694 - 1214750
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| | ||||||||||||||||| |
|
|
| T |
1214694 |
aaggctaaaatattgttttggtccctgcaaatatgtcgcattttggttttagtccct |
1214750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 6564580 - 6564636
Alignment:
| Q |
806 |
aggctaaaatatggtttt-ggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||| ||||||||| ||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
6564580 |
aggctaaattatggtttttggtccctgcaaatatgtctcgttttggttttagtccct |
6564636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 6564944 - 6564893
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6564944 |
aggctaaaat-tggttttggtccctgcaaatatgtctcgttttggttttagtc |
6564893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 8169786 - 8169842
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||| || |||||| ||||| |||||| |
|
|
| T |
8169786 |
aggctaaaatatgattttggtccatgcaaatatgttttgttttgattttactccctg |
8169842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 855
Target Start/End: Complemental strand, 494751 - 494704
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
494751 |
gctaaaatatggttttagtccctgcaaatatgtctcgttttggtttta |
494704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 806 - 857
Target Start/End: Complemental strand, 778043 - 777992
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||||||| |||||||| |
|
|
| T |
778043 |
aggctaaaatatggttttaatccctgcaaatatgcctcgttttagttttagt |
777992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 859
Target Start/End: Original strand, 34989962 - 34990013
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||| ||||||||| |
|
|
| T |
34989962 |
gctaaaatatgcttttagtccctgcaaatatgcctcgttttgattttagtcc |
34990013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 13150753 - 13150695
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| || || |||||||||| ||||||||||||||||||||| |
|
|
| T |
13150753 |
aaaggctaaaatatggtattaacccctgcaaatatgtctcgttttggttttagtccctg |
13150695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 14655976 - 14656018
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| ||||||| |
|
|
| T |
14655976 |
ttttggtctttgcaaatatgcatcgttttggttttggtccctg |
14656018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 866
Target Start/End: Complemental strand, 19129447 - 19129401
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
19129447 |
ttttggtccctgcaaatatgtctcgttttggttttggtccctgcaaa |
19129401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 19267915 - 19267857
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| | || ||||||| | |||||||||||||||||| |
|
|
| T |
19267915 |
aaaggctaaaatatggttttggttcctgtaaatatgtcccattttggttttagtccctg |
19267857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 19320840 - 19320882
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
19320840 |
ttttggtccttgcaaatatgcctcattttggttttggtccctg |
19320882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 806 - 848
Target Start/End: Complemental strand, 23770440 - 23770398
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgtttt |
848 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||| |
|
|
| T |
23770440 |
aggctaaaatatggttttagtccctgcaaatatgcctcgtttt |
23770398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 807 - 861
Target Start/End: Original strand, 30239293 - 30239347
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||| |||| || | |||||||||| |||||||||||||||||||| |
|
|
| T |
30239293 |
ggctaaaatatgattttagttcctgcaaatatgtctcgttttggttttagtccct |
30239347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 808 - 862
Target Start/End: Complemental strand, 31276339 - 31276285
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||| |||||||||||| |
|
|
| T |
31276339 |
gctaaaataaagttttggtccctgcaaatatgtctcgttttgattttagtccctg |
31276285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 31398543 - 31398489
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||| || ||||||||||||||| |
|
|
| T |
31398543 |
aaggctaaaatatgattttagtccctgcaaatatgtctcattttggttttagtcc |
31398489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 839
Target Start/End: Original strand, 29291358 - 29291391
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatg |
839 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
29291358 |
aggctaaaatatgcttttggtccttgcaaatatg |
29291391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 51; Significance: 1e-19; HSPs: 3)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 51; E-Value: 1e-19
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 54812 - 54870
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54812 |
aaaggctaaaatatggttttagtccttgcaaatatgcctcgttttggttttagtccctg |
54870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #2
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 50075 - 50019
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50075 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
50019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056; HSP #3
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 810 - 866
Target Start/End: Complemental strand, 55176 - 55120
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55176 |
taaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctgcaaa |
55120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 49; Significance: 2e-18; HSPs: 2)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 49; E-Value: 2e-18
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 82707 - 82651
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
82707 |
aggctaaaatatggttttggtccctgcaaatatgcctcgttttggttttagtccctg |
82651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026; HSP #2
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 866
Target Start/End: Original strand, 82339 - 82400
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
82339 |
aaggctaaaatatggttttggtccctgcaaatacgtctcgttttggttttagtccctgcaaa |
82400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 47; Significance: 3e-17; HSPs: 2)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 3921 - 3863
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
3921 |
aaaggctaaaatatggttttagtccctgcaaatatgcatcgttttggttttagtccctg |
3863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 3532 - 3584
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
3532 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
3584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 47; Significance: 3e-17; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 47; E-Value: 3e-17
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 47922 - 47980
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
47922 |
aaaggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
47980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 810 - 858
Target Start/End: Complemental strand, 48228 - 48180
Alignment:
| Q |
810 |
taaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || |||||||||||||| |
|
|
| T |
48228 |
taaaatatggttttggtccctgcaaatatgcctcattttggttttagtc |
48180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 806 - 859
Target Start/End: Complemental strand, 223173 - 223120
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| || |||||||||||||| |
|
|
| T |
223173 |
aggctaaaatatggttttggtccctgcaaatatgtctcactttggttttagtcc |
223120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1001 (Bit Score: 46; Significance: 1e-16; HSPs: 1)
Name: scaffold1001
Description:
Target: scaffold1001; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 2776 - 2833
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2776 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
2833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 46; Significance: 1e-16; HSPs: 2)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 46; E-Value: 1e-16
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 366275 - 366218
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
366275 |
aaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
366218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003; HSP #2
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 365979 - 366034
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
365979 |
ggctaaaatatggttttaatccttgcaaatatgcctcgttttggttttagtccctg |
366034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 14696 - 14752
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
14696 |
aggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
14752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 15013 - 14957
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
15013 |
aggctaaaatatggttttagtccctgcaaatatgtctcattttggttttagtccctg |
14957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0160
Description:
Target: scaffold0160; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 27365 - 27309
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
27365 |
aggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
27309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0160; HSP #2
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 820 - 862
Target Start/End: Original strand, 27072 - 27114
Alignment:
| Q |
820 |
ttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
27072 |
ttttggtccctgcaaatatgcctcgttttggttttggtccctg |
27114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 45; Significance: 4e-16; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 3751 - 3807
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||| |
|
|
| T |
3751 |
aggctaaaatatggttttggtccctgcaaatatgctttgttttggttttaatccctg |
3807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 858
Target Start/End: Complemental strand, 4080 - 4028
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
4080 |
aggctaaaatacggttttggtccctgcaaatatgtctcgttttagttttagtc |
4028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0684
Description:
Target: scaffold0684; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Complemental strand, 2661 - 2606
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
2661 |
aggctaaaatatggttttggtccctgcaaatatgccttgttttggttttagtccct |
2606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0684; HSP #2
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 806 - 855
Target Start/End: Original strand, 2333 - 2382
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| | | |||||||||||| |
|
|
| T |
2333 |
aggctataatatggttttggtccctgcaaatattccttgttttggtttta |
2382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0535
Description:
Target: scaffold0535; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 9028 - 8973
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9028 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0535; HSP #2
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 809 - 862
Target Start/End: Original strand, 8734 - 8787
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8734 |
ctaaaatatggttttagtccctgcaaatatgcctcgttttggttttagtccctg |
8787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 806 - 861
Target Start/End: Original strand, 2500 - 2555
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
2500 |
aggctaaaatatggttttgatccctgcaaatatgcttcgttttgattttagtccct |
2555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 35; E-Value: 0.0000000004
Query Start/End: Original strand, 807 - 861
Target Start/End: Complemental strand, 2883 - 2829
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccct |
861 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| |||||||||| |
|
|
| T |
2883 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttgagtttagtccct |
2829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 44; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 0.000000000000002
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 148282 - 148227
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
148282 |
ggctaaaatatggttttggtccctgcaaatatgtctcgttttggttttagtccctg |
148227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 2)
Name: scaffold0811
Description:
Target: scaffold0811; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 1308 - 1366
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
1308 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0811; HSP #2
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 862
Target Start/End: Complemental strand, 1647 - 1589
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||| ||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
1647 |
aaaggctaaaatatgaatttagtccctgcaaatatgcctcgttttggttttagtccctg |
1589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0712 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0712
Description:
Target: scaffold0712; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 5206 - 5264
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
5206 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
5264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0709 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0709
Description:
Target: scaffold0709; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 804 - 862
Target Start/End: Original strand, 5226 - 5284
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
5226 |
aaaggctaaaatatggttttagtccctgcaaatatgcctcgttttggttttattccctg |
5284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0373 (Bit Score: 42; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0373
Description:
Target: scaffold0373; HSP #1
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Original strand, 8545 - 8602
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
8545 |
aaggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtccctg |
8602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 42; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 42; E-Value: 0.00000000000003
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 291 - 234
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
291 |
aaggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtccctg |
234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0159 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0159
Description:
Target: scaffold0159; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 34931 - 34986
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||| || |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
34931 |
ggctaaaatatggtcttagtccctgcaaatatgcctcgttttggttttagtccctg |
34986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 2)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 12182 - 12237
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| ||||||| ||||||||||||| |
|
|
| T |
12182 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttagttttagtccctg |
12237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 12536 - 12484
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||| |||| |||| ||||||||||| |||||||||||||||||| |
|
|
| T |
12536 |
ggctaaaatatgattttagtccctgcaaatatgcctcgttttggttttagtcc |
12484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 40; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 40; E-Value: 0.0000000000004
Query Start/End: Original strand, 807 - 866
Target Start/End: Complemental strand, 44206 - 44147
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| ||||||||||| || ||||||| |
|
|
| T |
44206 |
ggctaaaatatggctttggtccctgcaaatatgcttcattttggttttaatcgctgcaaa |
44147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 39; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 805 - 859
Target Start/End: Complemental strand, 22057 - 22003
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| ||| |||||||||||||||||| |
|
|
| T |
22057 |
aaggctaaaatatggttttggtcccttcaaatttgcctcgttttggttttagtcc |
22003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 804 - 851
Target Start/End: Original strand, 21693 - 21739
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggt |
851 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
21693 |
aaaggctaaaatatggttttgatccctgcaaatatg-ttcgttttggt |
21739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 39; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 804 - 858
Target Start/End: Original strand, 5396 - 5450
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtc |
858 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| | ||||||||||||||| |
|
|
| T |
5396 |
aaaggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtc |
5450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 805 - 862
Target Start/End: Complemental strand, 5710 - 5653
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
5710 |
aaggctaaaatatggttttagtccctgcaaatatgtcttgttttggttttagtccctg |
5653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326 (Bit Score: 38; Significance: 0.000000000006; HSPs: 4)
Name: scaffold0326
Description:
Target: scaffold0326; HSP #1
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 4040 - 4093
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
4040 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
4093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #2
Raw Score: 38; E-Value: 0.000000000006
Query Start/End: Original strand, 806 - 859
Target Start/End: Original strand, 19222 - 19275
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
19222 |
aggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
19275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #3
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 4291 - 4236
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
4291 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
4236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0326; HSP #4
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 19473 - 19418
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
19473 |
aaaggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtcc |
19418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0347
Description:
Target: scaffold0347; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 814 - 866
Target Start/End: Original strand, 4016 - 4068
Alignment:
| Q |
814 |
atatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaaa |
866 |
Q |
| |
|
|||||||||| |||| | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4016 |
atatggttttagtccctacaaatatgcctcgttttggttttagtccctgcaaa |
4068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0347; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Complemental strand, 4312 - 4260
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||||||| ||||| |
|
|
| T |
4312 |
ggctaaaatatggttttagtccctgcaaatatgcctcgttttggtttgagtcc |
4260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 12525 - 12577
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||||||| |
|
|
| T |
12525 |
ggctaaaatatggttttagtccctgcaaatatgtctcgttttggttttagtcc |
12577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 3292 - 3236
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3292 |
aggctaaaatatggttttaatccctgcaaatatgtctcgttttggttttagtccctg |
3236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0166 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0166
Description:
Target: scaffold0166; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 24371 - 24427
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
24371 |
aggctaaaatatggttttagtcactgcaaatatgtctcgttttggttttagtccctg |
24427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0123 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0123
Description:
Target: scaffold0123; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 18044 - 17988
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
18044 |
aggctaaaatatggttttagtccctgcgaatatgcctcgttttggatttagtccctg |
17988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 35085 - 35029
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
35085 |
aggctaaaatatggttttgatccgtacaaatatgtctcgttttggttttagtccctg |
35029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 807 - 859
Target Start/End: Original strand, 10168 - 10220
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| | |||||||||||||||| |
|
|
| T |
10168 |
ggctaaaatatggttttagtccctgcaaatatgccttgttttggttttagtcc |
10220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 806 - 862
Target Start/End: Complemental strand, 10516 - 10460
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| | |||||||||||||| |||| |
|
|
| T |
10516 |
aggctaaaatatggttttagtccctgcaaatatgtctggttttggttttagttcctg |
10460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 37; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 805 - 865
Target Start/End: Original strand, 61630 - 61690
Alignment:
| Q |
805 |
aaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctgcaa |
865 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
61630 |
aaggctaaaatatggtattggtccctgcaaatatgcacagttttgattttagtccctgcaa |
61690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 37; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 806 - 862
Target Start/End: Original strand, 94056 - 94112
Alignment:
| Q |
806 |
aggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||| |||||||||||||| |||||| |
|
|
| T |
94056 |
aggctaaaatatggttttagtccctacaaatatgcctcgttttggttttaatccctg |
94112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 808 - 855
Target Start/End: Complemental strand, 94329 - 94282
Alignment:
| Q |
808 |
gctaaaatatggttttggtccttgcaaatatgcttcgttttggtttta |
855 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| |||||||||||||| |
|
|
| T |
94329 |
gctaaaatatggttttagtccctacaaatatgcctcgttttggtttta |
94282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Original strand, 16724 - 16779
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
16724 |
ggctaaaatatgattttggtccctgcaaatatatctcgttttggttttagtccctg |
16779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 36; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 807 - 862
Target Start/End: Complemental strand, 17966 - 17911
Alignment:
| Q |
807 |
ggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtccctg |
862 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||| ||||| |||||||| |
|
|
| T |
17966 |
ggctaaaatatggttttagtccctgcaaatatgcctcgtttcggtttcagtccctg |
17911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 36; Significance: 0.0000000001; HSPs: 2)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 859
Target Start/End: Original strand, 8327 - 8382
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||| ||||||||| |
|
|
| T |
8327 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060; HSP #2
Raw Score: 36; E-Value: 0.0000000001
Query Start/End: Original strand, 804 - 859
Target Start/End: Complemental strand, 8645 - 8590
Alignment:
| Q |
804 |
aaaggctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagtcc |
859 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||| |||||||| ||||||||| |
|
|
| T |
8645 |
aaaggctaaaatatggttttagtccctgcaaatatgtctcgttttgattttagtcc |
8590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 33; Significance: 0.000000006; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 33; E-Value: 0.000000006
Query Start/End: Original strand, 809 - 857
Target Start/End: Original strand, 17126 - 17174
Alignment:
| Q |
809 |
ctaaaatatggttttggtccttgcaaatatgcttcgttttggttttagt |
857 |
Q |
| |
|
|||||||||||||||||||| | |||||||| || |||||||||||||| |
|
|
| T |
17126 |
ctaaaatatggttttggtccctccaaatatgtttggttttggttttagt |
17174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University