View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916-Insertion-15 (Length: 151)
Name: NF5916-Insertion-15
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916-Insertion-15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 4e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 4e-73
Query Start/End: Original strand, 9 - 151
Target Start/End: Complemental strand, 44190920 - 44190778
Alignment:
| Q |
9 |
attcttgtagttgttcatgacatgaatatcattcatgggacatggtctcgtgtgtgttcataacatcacatataacacccattcatatatactctctcca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44190920 |
attcttgtagttgttcatgacatgaatatcattcatgggacatggtctcgtgtgtattcataacatcacatataacacccattcatatatactctctcca |
44190821 |
T |
|
| Q |
109 |
tgtgcatatgcagttcacgtggtacaaacatggtgaggtcggg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44190820 |
tgtgcatatgcagttcacgtggtacaaacatggtgaggtcggg |
44190778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University