View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_high_40 (Length: 262)
Name: NF5916_high_40
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_high_40 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 46 - 262
Target Start/End: Original strand, 15147953 - 15148167
Alignment:
| Q |
46 |
gtctctattcttatttgccaaagctcatcagtatataatgagtgagtagttttctcttttcctgggataatggcaagtagtcatatgacaaactttccat |
145 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||| |||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15147953 |
gtctctattcttatttgtcaaagctcatcactatgtaatgagtgagtagttgtctcttatcttgggataatggcaagtagtcatatgacaaactttccat |
15148052 |
T |
|
| Q |
146 |
gatcctcttcgtttcttttattttattgtgaaaactcataaccctaatcaagactaagtgtttgagcttgactaatcaagagattgatatcagcataaga |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15148053 |
gatcctcttcgtttcttttattttattgtgaaaactcataaccctaattaagacgaagtgtttgagcttgactaatca--agattgatatcagcataaga |
15148150 |
T |
|
| Q |
246 |
agttgaagttgaagtaa |
262 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15148151 |
agttgaagttgaagtaa |
15148167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University