View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_high_44 (Length: 256)
Name: NF5916_high_44
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_high_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 3591470 - 3591700
Alignment:
| Q |
11 |
ttatactcaacgagtcaatgtaattaaaatcgcaatcttgaaagtgggattgcaccacaatttcacgactcgagaccctcactatgtgaggagcaactgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3591470 |
ttatactcaacgagtcaatgtaattaaaatcgcaatcttgaaagtgggattgccccacaatttcacgactcgagaccctcactatgtgaggagcaactgt |
3591569 |
T |
 |
| Q |
111 |
gtcacacatgggattgccagcaggagggatcgtggtcttttccagcatgatcattggatcgaaggaggaaagccacgaacattgacttgttctgatatcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
3591570 |
gtcacacatgggattgccagcaggagggatcgtggtcttttccagcatgatcattggatcgaaggaggaaagcctcgaacattgacttgatctgatatcc |
3591669 |
T |
 |
| Q |
211 |
gggtcagtatttcacaaaaccttcacctccc |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3591670 |
gggtcagtatttcacaaaaccttcacctccc |
3591700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University