View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_high_47 (Length: 249)
Name: NF5916_high_47
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_high_47 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 125
Target Start/End: Complemental strand, 15147862 - 15147742
Alignment:
| Q |
3 |
ataatgggtcaaaatagcatatttccctaaaaatgggtgttcatttttgccnnnnnnnnaataagggatcaaaaccgctactttttcaaacttaaagggt |
102 |
Q |
| |
|
||||||| |||||| |||||||||||||||| ||||| || || ||||||| |||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
15147862 |
ataatggatcaaaagagcatatttccctaaacatgggggt-cacttttgccttttttt-aataagcgatcaaaaccgctactttttcaaacttagagggt |
15147765 |
T |
 |
| Q |
103 |
gaatagtgcgattaagcctattt |
125 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
15147764 |
gaataatgcgattaagcctattt |
15147742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 67 - 125
Target Start/End: Complemental strand, 1074988 - 1074930
Alignment:
| Q |
67 |
gggatcaaaaccgctactttttcaaacttaaagggtgaatagtgcgattaagcctattt |
125 |
Q |
| |
|
|||||||||| | |||||||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
1074988 |
gggatcaaaatcactacttttgcaaacttagagggtgaatagtgctcttaagcctattt |
1074930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 26127159 - 26127207
Alignment:
| Q |
72 |
caaaaccgctactttttcaaacttaaagggtgaatagtgcgattaagcc |
120 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||||||||||| ||||||| |
|
|
| T |
26127159 |
caaaatcgctacttttgcaaacttagagggtgaatagtgcgtttaagcc |
26127207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 120
Target Start/End: Original strand, 26177209 - 26177257
Alignment:
| Q |
72 |
caaaaccgctactttttcaaacttaaagggtgaatagtgcgattaagcc |
120 |
Q |
| |
|
||||| |||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
26177209 |
caaaatcgctacttttgcaaacttagagggtgaatagtgcatttaagcc |
26177257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 71 - 122
Target Start/End: Original strand, 81016 - 81067
Alignment:
| Q |
71 |
tcaaaaccgctactttttcaaacttaaagggtgaatagtgcgattaagccta |
122 |
Q |
| |
|
|||||| |||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
81016 |
tcaaaatcgctacttttgcaaacttagggggtgaatagtgcgtttaagccta |
81067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 72 - 122
Target Start/End: Complemental strand, 4370946 - 4370896
Alignment:
| Q |
72 |
caaaaccgctactttttcaaacttaaagggtgaatagtgcgattaagccta |
122 |
Q |
| |
|
||||| |||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
4370946 |
caaaatcgctacttttgcaaacttagggggtgaatagtgcgtttaagccta |
4370896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University