View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_high_55 (Length: 235)
Name: NF5916_high_55
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_high_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5693822 - 5693602
Alignment:
| Q |
1 |
tggccaacatgctttgtatatggcaaggcgagctaagggggctccaccagaagctgtaccgctggcgaagcctccgattgctgcagcatttttaatggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5693822 |
tggccaacatgctttgtatatggcaaggcgggctaagggggctccgccagaggctgtaccgctggcgaagcctccgattgctgcagcatttttaatggtt |
5693723 |
T |
|
| Q |
101 |
cgccctgccactattgaagatgtgtgtgttccatggccatctttgtcgcgagctgatttgtaatcctcctcttcgtttagtgggccataatgattttcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5693722 |
cgccctgccactattgaagatgtgtgtgttccatggccatctttgtcgcgagctgatttgtaatcctcctcttcgtttagtgggccataatgattttcat |
5693623 |
T |
|
| Q |
201 |
aaccttgcaagtagtaccttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5693622 |
aaccttgcaagtagtaccttg |
5693602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5683946 - 5683726
Alignment:
| Q |
1 |
tggccaacatgctttgtatatggcaaggcgagctaagggggctccaccagaagctgtaccgctggcgaagcctccgattgctgcagcatttttaatggtt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||| || || ||||||||||||| ||||| ||||||| || | | |
|
|
| T |
5683946 |
tggccaacatgctttgtatattgcaaggcgagctaatggggctccaccagaggctgtgcctctagcgaagcctccgagtgctgatgcattttgaactgct |
5683847 |
T |
|
| Q |
101 |
cgccctgccactattgaagatgtgtgtgttccatggccatctttgtcgcgagctgatttgtaatcctcctcttcgtttagtgggccataatgattttcat |
200 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
5683846 |
cgccctgctactattgaagccgtgtgtgttccatgaccatctttgtcgcgagctgatttgtaatcctcctcttcatttagagggccatagattttttcat |
5683747 |
T |
|
| Q |
201 |
aaccttgcaagtagtaccttg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5683746 |
aaccttgcaagtagtaccttg |
5683726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University