View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_high_57 (Length: 233)
Name: NF5916_high_57
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_high_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 18804301 - 18804500
Alignment:
| Q |
19 |
tttttcctttataatgttacaatttatttattactaatagaaatgttaatggaagcaggcttctcaaaagggtatcataggcatcacattaaactgtaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18804301 |
tttttcctttataatgttacaatttatttattactaatagaaatgttaatggaagcaggcttctcaaaagggtataataggcatcacattaaactgtacc |
18804400 |
T |
 |
| Q |
119 |
tggtttttgccgcaatcggataacccgttagatcatcaagctgccgaacgtgcccttgatttattgcttggatggtaatgactatatttttcttaccttt |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18804401 |
tggtttttgccgcaatcagataacccgttagatcatcaagctgccgaacgtgcccttgatttattgcttggatggtaatgactatattcttcttaccttt |
18804500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 64 - 195
Target Start/End: Complemental strand, 25038528 - 25038397
Alignment:
| Q |
64 |
ttaatggaagcaggcttctcaaaagggtatcataggcatcacattaaactgtacatggtttttgccgcaatcggataacccgttagatcatcaagctgcc |
163 |
Q |
| |
|
||||||| | |||||||||||||| ||| ||||||||||| ||||| ||| |||||||||||| || || || ||||||||||||||||| || |
|
|
| T |
25038528 |
ttaatggcatcaggcttctcaaaatggttcaataggcatcaccttaaattgtcactggtttttgccgttctcaaatgacacgttagatcatcaagcttcc |
25038429 |
T |
 |
| Q |
164 |
gaacgtgcccttgatttattgcttggatggta |
195 |
Q |
| |
|
|||||||| |||||||| || |||||||||| |
|
|
| T |
25038428 |
gaacgtgctcttgatttcatgtttggatggta |
25038397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 146 - 198
Target Start/End: Complemental strand, 25017345 - 25017293
Alignment:
| Q |
146 |
ttagatcatcaagctgccgaacgtgcccttgatttattgcttggatggtaatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
25017345 |
ttagatcatcaagctgccgaacgtgctcttgattacatgtttggatggtaatg |
25017293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 141 - 202
Target Start/End: Complemental strand, 4599901 - 4599840
Alignment:
| Q |
141 |
acccgttagatcatcaagctgccgaacgtgcccttgatttattgcttggatggtaatgacta |
202 |
Q |
| |
|
|||| |||||||| ||||| ||||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
4599901 |
acccattagatcaacaagccaccgaacgcgcccttgatttcatgtttggatggtaatgacta |
4599840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University