View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_low_16 (Length: 475)
Name: NF5916_low_16
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 360; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 360; E-Value: 0
Query Start/End: Original strand, 57 - 457
Target Start/End: Complemental strand, 45037938 - 45037539
Alignment:
| Q |
57 |
gctgaaatatagcaccaaccatttcccctggtcttgnnnnnnnttctagaacggttgcacctaaacttttttactcacttccataataatttccatcgtt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45037938 |
gctgaaatatagcaccaaccatttccccttgtcttgaaaaaaattcttgaacggttgcacctaaacttttt-actcacttccataataatttccatcgtt |
45037840 |
T |
|
| Q |
157 |
attccttacttcattttttatgtttttgcttccattgcacgaatgaatggtcaccaaaaaacagctcagtttaagctgctgaaggtgctgtgacatattg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037839 |
attccttacttcattttttatgtttttgcttccattgcacgaatgaatggtcaccaaaaaacagctcagtttaagctgctgaaggtgctgtgacatattg |
45037740 |
T |
|
| Q |
257 |
aacacgacctacctcagacaatgcttgtacgaatggctcaatttcaacaccattcgtttgtacttcaccacttccactcaaattcttgttgtaatcaaga |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037739 |
aacacgacctacctcagacaatgcttgtacgaatggctcaatttcaaaaccattcgtttgtacttcaccacttccactcaaattcttgttgtaatcaaga |
45037640 |
T |
|
| Q |
357 |
gatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccctgtgtatctccaaggctttgatc |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45037639 |
gatgaatcattgtaaatatcccaccatttcttgactagcattcttatatcctccctttgcatgttttcttccttccctgtgtatctccaaggctttgatc |
45037540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University