View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_low_47 (Length: 250)
Name: NF5916_low_47
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 2978498 - 2978738
Alignment:
| Q |
1 |
tttaaaaaatgattgaactaattttaacaatgccaacgtgaattaattcacgctgaataagggaatgagtagttttggaaaggagaagagcaattttcct |
100 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
2978498 |
tttaaaaaatggttgaaccgattttaacattgcaaacgtgaattaattcacgctgaataaaggaatgggtagttttggaaaggagaaaagcaattttcct |
2978597 |
T |
 |
| Q |
101 |
ccgtcaaaacatataaaaatttattcaa---gnnnnnnnnnncttccccgtagtttgctaatagactttcacctttaaggtgaataaataataaatttag |
197 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2978598 |
ccg-caaaacatataaaaatttattcaatttttttttttcttcttcccagtagtttgctaatagactttcacctttaaggtgaataaataataaatttaa |
2978696 |
T |
 |
| Q |
198 |
acttcgaactcaaatttttgtatatttcaacgtattgttcat |
239 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2978697 |
acttcaaactcatatttttgtatatttcaacgtattgttcat |
2978738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University