View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_low_52 (Length: 240)
Name: NF5916_low_52
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_low_52 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 31093007 - 31092793
Alignment:
| Q |
1 |
tgatgggtgcaacaattatgattcacttgaaaatactaaccttaccataccaacaatttgaaagggaaccggttttatataacatagaaattcgttgaac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
31093007 |
tgatgggtgcaacaattatgattcacttgaaaatactaaccttaccataccaacaatttgaaagggaaccggttttacataacatagcaattcgttgaac |
31092908 |
T |
|
| Q |
101 |
tcaacaatttgaaagttaaccgtaatttgccgaagattaagattttagtttggaagtcttgattggggatgagttaacagtttactagttcaagtatgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31092907 |
tcaacaatttgaaagttaaccgtaatttgccgaagattaagattttagtttggaagtcttgattggggatgagttaacagtttactagttcaagtatgta |
31092808 |
T |
|
| Q |
201 |
atacactaataggaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
31092807 |
atacactaataggaa |
31092793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 31048326 - 31048369
Alignment:
| Q |
2 |
gatgggtgcaacaattatgattcacttgaaaatactaaccttac |
45 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
31048326 |
gatggctgcaacaattatgattcacatgaaaaaactaaccttac |
31048369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University