View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5916_low_52 (Length: 240)

Name: NF5916_low_52
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5916_low_52
NF5916_low_52
[»] chr6 (2 HSPs)
chr6 (1-215)||(31092793-31093007)
chr6 (2-45)||(31048326-31048369)


Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Complemental strand, 31093007 - 31092793
Alignment:
1 tgatgggtgcaacaattatgattcacttgaaaatactaaccttaccataccaacaatttgaaagggaaccggttttatataacatagaaattcgttgaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||    
31093007 tgatgggtgcaacaattatgattcacttgaaaatactaaccttaccataccaacaatttgaaagggaaccggttttacataacatagcaattcgttgaac 31092908  T
101 tcaacaatttgaaagttaaccgtaatttgccgaagattaagattttagtttggaagtcttgattggggatgagttaacagtttactagttcaagtatgta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31092907 tcaacaatttgaaagttaaccgtaatttgccgaagattaagattttagtttggaagtcttgattggggatgagttaacagtttactagttcaagtatgta 31092808  T
201 atacactaataggaa 215  Q
    |||||||||||||||    
31092807 atacactaataggaa 31092793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 45
Target Start/End: Original strand, 31048326 - 31048369
Alignment:
2 gatgggtgcaacaattatgattcacttgaaaatactaaccttac 45  Q
    ||||| ||||||||||||||||||| |||||| |||||||||||    
31048326 gatggctgcaacaattatgattcacatgaaaaaactaaccttac 31048369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University