View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5916_low_59 (Length: 233)

Name: NF5916_low_59
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5916_low_59
NF5916_low_59
[»] chr7 (1 HSPs)
chr7 (14-217)||(38981837-38982040)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 14 - 217
Target Start/End: Original strand, 38981837 - 38982040
Alignment:
14 aaaatattattaatggcagacaatgtacttcattcctaaatgactaagccttcaattattagtttttattggtaacttcaattaattctacttttttaac 113  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38981837 aaaatattattaatggcagacaatgtaattcattcctaaatgactaagccttcaattattagtttttattggtaacttcaattaattctacttttttaac 38981936  T
114 catccattgctaaggaatggagttttatagttgatagctcgattggttgctaatagtttctaaggaagggagttttatggttgatatttcgattgggagt 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
38981937 catccattgctaaggaatggagttttatagttgatagctcgattggttgctaatagtttctaaggaagggagttttatggttgatattttgattgggagt 38982036  T
214 taat 217  Q
    ||||    
38982037 taat 38982040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University