View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_low_62 (Length: 223)
Name: NF5916_low_62
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 6 - 207
Target Start/End: Complemental strand, 37345799 - 37345598
Alignment:
| Q |
6 |
acatcatcagatgaggattgtaaacaaggaaattaagggtatacaaatattcatcattaaaaaatgaattaaatgnnnnnnntaatataattacatacct |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37345799 |
acataatcagatgaggattgtaaacaaggaaattaagggtatacaaatattcatcattaaaaaatgaattaaatgaaaaaaataatataattacatacct |
37345700 |
T |
 |
| Q |
106 |
taggactattaacaggtgagctagcagtgtcctccaaagggtcatcttctgatatttgtttggttcttgatttcttcaaagagagtttcttagagaggtt |
205 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37345699 |
taggactattgacaggtgagctagcagtgtcctccaaagggtcatcttctgatatttgtttggttcttgatttcttcaaagagagtttcttagagaggtt |
37345600 |
T |
 |
| Q |
206 |
tg |
207 |
Q |
| |
|
|| |
|
|
| T |
37345599 |
tg |
37345598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 196
Target Start/End: Original strand, 16735382 - 16735477
Alignment:
| Q |
101 |
taccttaggactattaacaggtgagctagcagtgtcctccaaagggtcatcttctgatatttgtttggttcttgatttcttcaaagagagtttctt |
196 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||||| || || ||||||||||| |||||||| ||||| ||||| |||||| ||| | |||||||| |
|
|
| T |
16735382 |
taccttgggactattgacaggagagctagcagtatcttctaaagggtcatcatctgatataattttggatcttgttttcttgaaacaaagtttctt |
16735477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University