View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5916_low_67 (Length: 201)
Name: NF5916_low_67
Description: NF5916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5916_low_67 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 12 - 186
Target Start/End: Original strand, 17506578 - 17506752
Alignment:
| Q |
12 |
attatacttgataaataacataaaagtttcatgtatatgtttgtccacataattgaatcttgatgaaatcttccacttgcatttcatgcaatcaaagaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17506578 |
attatacttgataaataacataaaagtttcatgtatatgtttgtccacataattgaatcttgatgaaatcttccacttgcattgcatgcaatcaaagaca |
17506677 |
T |
 |
| Q |
112 |
aaccttgtccagctcacgatgaagctccaaaagtgtaaaggatccaaaagaaaacgattgggtatatatagtttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17506678 |
aaccttgtccagctcacgatgaagctccaaaagtgtaaaggatccaaaagaaaacgattgggtatatatattttg |
17506752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University