View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5917-Insertion-8 (Length: 336)
Name: NF5917-Insertion-8
Description: NF5917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5917-Insertion-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 9 - 336
Target Start/End: Complemental strand, 29275002 - 29274675
Alignment:
| Q |
9 |
ccaataccatcagaattagaaagatcaagcaagtgttccatgttcgaagtcctagggtgatgcaaccacatacaaccatccataaactgcacgccattgg |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29275002 |
ccaataccatcggaattagaaagatcaagcaagtgtttcatgttcgaagtcctagggtgatgcaaccacatacaaccatccataaactgcacgccattgg |
29274903 |
T |
|
| Q |
109 |
cttcacaagcttctaagatcaaatcaagctctgccacatcaagtgctgccggcttctccaccaacacatgcttcttcttattcgcggcagcaaccgccca |
208 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29274902 |
cctcacaagcttctaagatcaaatcaagctctgccacatcaagtgctgccggcttctccaccaacacatgcttcttcttattcgcagcagcaaccgccca |
29274803 |
T |
|
| Q |
209 |
cctcacgtgcagactagtcgggagaggaatgtacactgcatccacacctgaatcttccacaacctcatcatagctaccatagattcttacgctggctggt |
308 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274802 |
cctcacgtgcagactcgttgggagaggaatgtacactgcatccacacctgaatcttccacaacctcatcatagctaccatagattcttacgctggctggt |
29274703 |
T |
|
| Q |
309 |
aaactgttttcgactgcaaattttgctg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29274702 |
aaactgttttcgactgcaaattttgctg |
29274675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 60 - 121
Target Start/End: Complemental strand, 24579200 - 24579139
Alignment:
| Q |
60 |
ctagggtgatgcaaccacatacaaccatccataaactgcacgccattggcttcacaagcttc |
121 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
24579200 |
ctagggtgatgcaaccacattgaaccatccataaactgcactccattagtctcacaagcttc |
24579139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University