View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5917-Insertion-9 (Length: 313)
Name: NF5917-Insertion-9
Description: NF5917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5917-Insertion-9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 86 - 313
Target Start/End: Original strand, 39991774 - 39992000
Alignment:
| Q |
86 |
cctagaattttcattcaatcttatgagtgagttggttttgtttaatgtaacgtgatataattttgtgtcccacgtttttgtcacttatgaaagatgataa |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991774 |
cctagaattttcattcaatcttatgagtgagttggttttgtttattgtcacgtgatataattttgtgtcccacgtttttgtcacttatgaaagatgataa |
39991873 |
T |
|
| Q |
186 |
cagcaagattgacaagatcttannnnnnncagcatatttttatgggtcttggatactatcatttgatgaattttgcacgcttcttcttttgacttgttag |
285 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39991874 |
cagcaagattgacaagatctta-ttttttcagcatatttttatgggtcttggatactatcatttgatgaattttgcacgcttcttcttttgacttgttag |
39991972 |
T |
|
| Q |
286 |
gtggcattattgcttagggttgtttatc |
313 |
Q |
| |
|
||||||||||| |||||||||||||||| |
|
|
| T |
39991973 |
gtggcattatttcttagggttgtttatc |
39992000 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University