View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5917_low_6 (Length: 363)
Name: NF5917_low_6
Description: NF5917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5917_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 310; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 310; E-Value: 1e-174
Query Start/End: Original strand, 20 - 353
Target Start/End: Complemental strand, 29275002 - 29274669
Alignment:
| Q |
20 |
ccaataccatcagaattagaaagatcaagcaagtgttccatgttcgaagtcctagggtgatgcaaccacatacaaccatccataaactgcacgccattgg |
119 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29275002 |
ccaataccatcggaattagaaagatcaagcaagtgtttcatgttcgaagtcctagggtgatgcaaccacatacaaccatccataaactgcacgccattgg |
29274903 |
T |
 |
| Q |
120 |
cttcacaagcttctaagatcaaatcaagctctgccacatcaagtgctgccggcttctccaccaacacatgcttcttcttattcgcggcagcaaccgccca |
219 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29274902 |
cctcacaagcttctaagatcaaatcaagctctgccacatcaagtgctgccggcttctccaccaacacatgcttcttcttattcgcagcagcaaccgccca |
29274803 |
T |
 |
| Q |
220 |
cctcacgtgcagactagtcgggagaggaatgtacactgcatccacacctgaatcttccacaacctcatcatagctaccatagattcttacgctggctggt |
319 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29274802 |
cctcacgtgcagactcgttgggagaggaatgtacactgcatccacacctgaatcttccacaacctcatcatagctaccatagattcttacgctggctggt |
29274703 |
T |
 |
| Q |
320 |
aaactgttttcgactgcaaattttgctgcctttg |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29274702 |
aaactgttttcgactgcaaattttgctgcctttg |
29274669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 71 - 132
Target Start/End: Complemental strand, 24579200 - 24579139
Alignment:
| Q |
71 |
ctagggtgatgcaaccacatacaaccatccataaactgcacgccattggcttcacaagcttc |
132 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||||| | ||||||||||| |
|
|
| T |
24579200 |
ctagggtgatgcaaccacattgaaccatccataaactgcactccattagtctcacaagcttc |
24579139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University