View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918-Insertion-13 (Length: 390)
Name: NF5918-Insertion-13
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918-Insertion-13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 9 - 302
Target Start/End: Complemental strand, 38943000 - 38942708
Alignment:
| Q |
9 |
gatggaacttttattgtaagtgcaactgttaatggattggttgaaggaatttagtaggaatgagagttatgaatatgactgtggttgggtggttgattga |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38943000 |
gatggaacttttattgtaagtgcaactgttaatggattggttgaaggaatttagtaggaatgagagttatgaatatgactgtggttgggtggttgattga |
38942901 |
T |
|
| Q |
109 |
attgcagggtaatttggaacgggaagtgattgtgtacaactaaagggagatgagattattgtgatagtatgaattgttgaggttgttgtgattgtctatt |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |||| || |||||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38942900 |
attgcagggtaatttggaatgggaagtgattgtgtacaactaaa-ggaggtgggattattgtggtagtatgaattgttgaggttgttgtcattgtctatt |
38942802 |
T |
|
| Q |
209 |
ctttttactatgaagccatttcctgtgtgtgtagattcagttgagnnnnnnnngtagaagtagattcaggaaagttttttgaaaaggaaaacag |
302 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38942801 |
ctttttactctgaagccatttcctctgtgtgtagattcagttgagttttttaggtacaagtagattcaggaaagctttttgaaaaggaaaacag |
38942708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 130 - 248
Target Start/End: Original strand, 13723893 - 13724013
Alignment:
| Q |
130 |
ggaagtgattgtgtacaactaaagggagatgagattattgtg--atagtatgaattgttgaggttgttgtgattgtctattctttttactatgaagccat |
227 |
Q |
| |
|
|||||||||||||| | ||||| |||||||| |||||||| || |||||| | ||||||||||| ||||| ||| |||||| | | |||||||| |
|
|
| T |
13723893 |
ggaagtgattgtgttgagctaaaaggagatgaaattattgtagaattgtatgagctattgaggttgttaacattgtgtatgcttttttccaagaagccat |
13723992 |
T |
|
| Q |
228 |
ttcctgtgtgtgtagattcag |
248 |
Q |
| |
|
||||||||| | ||||||||| |
|
|
| T |
13723993 |
ttcctgtgtttttagattcag |
13724013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University