View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_high_57 (Length: 244)
Name: NF5918_high_57
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_high_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 102 - 229
Target Start/End: Original strand, 43870406 - 43870533
Alignment:
| Q |
102 |
cttaaaaaattgtgtaatttttactttagatatgtttgacagtatttacaaaacaaaagtttgtttccgtggagnnnnnnnagagcacttgtaaccatga |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43870406 |
cttaaaaaattgtgtaatttttactttagatatatttgacagtatttacaaaacaaaagtttgtttccgtggagtttttttagagcacttgtaaccatga |
43870505 |
T |
 |
| Q |
202 |
ttcgtattttatgaatgttggtgtaaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
43870506 |
ttcgtattttatgaatgttggtgtaaat |
43870533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 64 - 128
Target Start/End: Original strand, 9301018 - 9301082
Alignment:
| Q |
64 |
ttaggcattgtttaaacaattaatagtgatagcttttacttaaaaaattgtgtaatttttacttt |
128 |
Q |
| |
|
||||| ||||||||| ||||||| ||||||| |||||| ||||||||||||||||| ||||||| |
|
|
| T |
9301018 |
ttaggtattgtttaagcaattaaaagtgataacttttatataaaaaattgtgtaattattacttt |
9301082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University