View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_39 (Length: 331)
Name: NF5918_low_39
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 323
Target Start/End: Complemental strand, 42835482 - 42835180
Alignment:
| Q |
17 |
attatagcgccagaataaccgctatttaataacactttatattaaatggcgtattgtgaaacataagtgattagttcaaattctactacactatatgatc |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
42835482 |
attatagcgccacaataaccgctatttaataacactttatattaaatggcatattgcgaaacatcagtgattagttcaaattctactacactaaatgatc |
42835383 |
T |
 |
| Q |
117 |
tactannnnnnnnnnnnnnnngttgaagaaatatagttctactatttgacaacgctaataaacaactcacattttttgttctcttgatcacctgctcttt |
216 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42835382 |
tactatttttttttttt----gttgaagaaatatagttctattatttgacaacgctaataaacaactcacattttttgttctcttgatcacctgctcttt |
42835287 |
T |
 |
| Q |
217 |
caatgatgctttaagctcacgaatgtatgtctttgtatttgtaatttgatcgtcgcaagagcatatctcaatcttaagcttatcaatcttgacatcggct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42835286 |
caatgatgctttaagctcacgaatgtatgtctttgtatttgtaatttgatcgtcgcaagagcatatctcaatcttaagcttatcaatcttgacatcggct |
42835187 |
T |
 |
| Q |
317 |
tcatctc |
323 |
Q |
| |
|
||||||| |
|
|
| T |
42835186 |
tcatctc |
42835180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University