View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_44 (Length: 294)
Name: NF5918_low_44
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 35 - 241
Target Start/End: Complemental strand, 43312509 - 43312302
Alignment:
| Q |
35 |
gttgcagcggaaatttaatttaaatattgtagacaaccaagggttaggtctagcgaaagatgctagatttccacgatacgacaaattaatgtccgaatct |
134 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43312509 |
gttgtagcggaaatttaatttaaatattgtacacaatcaagggttaggtctagcgaaagatgctagatttccacgatacgacaaattaatgtccgaatct |
43312410 |
T |
 |
| Q |
135 |
taatataattctcaattaatgtctgacacgtctataatagtattacctcgatcagttggattgaagccctaaaaactc-agaaaaacattattttatcca |
233 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||| |
|
|
| T |
43312409 |
taatataattcttaattaatgtctgacacgtctataatagtattacctcgatcagttggattgaagccctaaaaactcaaaaaaaacattattttaccca |
43312310 |
T |
 |
| Q |
234 |
ttctcatc |
241 |
Q |
| |
|
| |||||| |
|
|
| T |
43312309 |
tcctcatc |
43312302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University