View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_50 (Length: 255)
Name: NF5918_low_50
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_50 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 54 - 255
Target Start/End: Complemental strand, 52531557 - 52531356
Alignment:
| Q |
54 |
cattctttttcagtttttgactctctttatcattacaaatttaatagttatagatcattaatgcatcatcaagatcatacatatcaatatgtcaaaatca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52531557 |
cattctttttcagtttttgactctctttatcattacaaatttaatagttatagatcattaatgcatcatcaagatcatacatatcaatatgtcaaaatca |
52531458 |
T |
 |
| Q |
154 |
atggaactccctgattgtatctatccatgccaaccaatcactagtatttcaccaagtattccaacgccaaaacattctctctatctttctaatcttgatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52531457 |
atggaactccctgattgtatctatccatgccaaccaatcactagtattccaccaagtattccaacgccaaaacattctctctatctttctaatcttgatg |
52531358 |
T |
 |
| Q |
254 |
ac |
255 |
Q |
| |
|
|| |
|
|
| T |
52531357 |
ac |
52531356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 52531609 - 52531574
Alignment:
| Q |
19 |
tttggtaaccccctcttttcataaattattccctac |
54 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
52531609 |
tttgataaccccctcttttcataaattattccctac |
52531574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University