View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_51 (Length: 254)
Name: NF5918_low_51
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_51 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 11 - 254
Target Start/End: Complemental strand, 16623683 - 16623440
Alignment:
| Q |
11 |
cgaagaaaatataagcatcaaatatttacagggaaccataaatgcttcaagagagtagagttaacatacatcaagaatgggattatttggtccacgtctt |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16623683 |
cgaaaaaaatataagcatcaaatatttacagggaaccataaatgcttcaagagagtagagttaacatacatcaagaatgggattatttggtccacgtctt |
16623584 |
T |
|
| Q |
111 |
gttttcctgtgattcttctccggacacctgctaccaaatgaaacaatagtttcttaagagacgttgaaagtgaaccggatacagtatctttattattatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
16623583 |
gttttcctgtgattcttctccggacacctgctaccaaatgaaacaatagtttcttaagagacgttgaaagtgaactggatacaatatctttattattatt |
16623484 |
T |
|
| Q |
211 |
agtatgttgtcaatagtgccctatagcgacactatagtggaata |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16623483 |
agtatgttgtcaatagtgccctatagcgacactatagtggaata |
16623440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University