View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_58 (Length: 248)
Name: NF5918_low_58
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 33223419 - 33223181
Alignment:
| Q |
1 |
cttcttgttttgtttctttctttctatacccatccagaaacttggaacacggttaggatcatctttgcccacttgataattctctattataacgtctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223419 |
cttcttgttttgtttctttctttctatacccatccagaaacttggaacacggttaggatcatctttgcccacttgataattctctattataacgtctgca |
33223320 |
T |
|
| Q |
101 |
cgcttgatagtctcgtgcctcttgatcttttccaactcaagtgtgaaatcttggatccattttttgttggtacctccatagataaagatgtatctgtcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223319 |
cgcttgatagtctcgtgcctcttgatcttttccaactcaagtgtgaaatcttggatccattttttgttggtacctccatagataaagatgtatctgtcca |
33223220 |
T |
|
| Q |
201 |
ctttcacctgaatcacatgataaaaagatataagatatt |
239 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33223219 |
ctttcacctgaatcacatgataaaatgatataagatatt |
33223181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 142 - 209
Target Start/End: Complemental strand, 33238729 - 33238662
Alignment:
| Q |
142 |
tgtgaaatcttggatccattttttgttggtacctccatagataaagatgtatctgtccactttcacct |
209 |
Q |
| |
|
|||||| ||||||||||||||||||| | ||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
33238729 |
tgtgaagtcttggatccattttttgtcactgcctccatagatgaatatgtatctgtctcctttcacct |
33238662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University