View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_62 (Length: 236)
Name: NF5918_low_62
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 33223701 - 33223497
Alignment:
| Q |
19 |
actataggtatcaacattaagaacttcacatggttcacgaccagatatctctttagccttcatctgataatactctttaaatgcaatatcaaacccttct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33223701 |
actataggtatcaacattaagaacttcacatggttcacgaccagatatctctttagccttcatctgataatactctttaaatgcaatatcaaacccttct |
33223602 |
T |
 |
| Q |
119 |
ttctccaacactttgtctttccaattctgaaactcaaccaaagtttgataagccggctcgccgtgaccaagaagtttaatgctatatcctttgcttagaa |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33223601 |
ttctccaacactttgtctttccaattctgaaactcaaccaaagtttgataagccggctcgccgtgaccaagaagtttaatgctatgtcctttgcttagaa |
33223502 |
T |
 |
| Q |
219 |
taatc |
223 |
Q |
| |
|
||||| |
|
|
| T |
33223501 |
taatc |
33223497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University