View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5918_low_66 (Length: 220)
Name: NF5918_low_66
Description: NF5918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5918_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 52113462 - 52113274
Alignment:
| Q |
19 |
cgaaccacccaaaaaactttcaatgcgaagaatccctggagattacggcctcccattcgtaggtcctatcaaagaccgtcttgaatatttctacaacgaa |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113462 |
cgaaccacccaaaaaacttccaatgcgaagaatccctggagattacggcctcccattcgtaggtcctatcaaagaccgtcttgaatatttctacaacgaa |
52113363 |
T |
 |
| Q |
119 |
ggcggccgcgacaaatatttcagaagtaaaatgcacaaatacaaatcaaccatttttcgcgctaatatgccaccaggcccattcatttc |
207 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113362 |
ggcggccgcgacaaatatttcagaagcaaaatgcacaaatacaaatcaaccatttttcgcgctaatatgccaccaggcccattcatttc |
52113274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University