View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5919_high_12 (Length: 299)
Name: NF5919_high_12
Description: NF5919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5919_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 283
Target Start/End: Complemental strand, 4585217 - 4584942
Alignment:
| Q |
11 |
caaaggttggttttctgttgggtaagtactactgagcccttcatcaattttattttatttctaaaatttctgtaattttcaaatagattgttttctaaac |
110 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || | ||||||||||||||| |||||| |
|
|
| T |
4585217 |
caaaggttggtgttctgttgggtaagtactactgagcccttcatcaattttattttatttctaaaatgtctttattattcaaatagattgttcactaaac |
4585118 |
T |
|
| Q |
111 |
tagagaatttattttggtagatttggcatagattttcatagagttg-tttagttatgcaatcttttcattgta-tttatactattttcagtattaggga- |
207 |
Q |
| |
|
|||||||||| || |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
4585117 |
tagagaatttgttgtggtagatttggcataaattttcatagagttgttttagttatgcaatcttttcattgtattttataccgttttcagtattagggat |
4585018 |
T |
|
| Q |
208 |
tatcaagctttcagattttcattttagttccatttttagtggtatcatgcttttaatttactgacgcggttacatt |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4585017 |
tatcaagctttcagattttcattttagttccatttttactggtatcatgcttttaatttactgacgcggttacatt |
4584942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University