View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5919_low_10 (Length: 313)
Name: NF5919_low_10
Description: NF5919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5919_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 7 - 176
Target Start/End: Original strand, 50732247 - 50732414
Alignment:
| Q |
7 |
taaattatactaacttattcagtgatgctatttccagtagttgattttggttctttatatatagcaaaacatggggttgatggaaaatagaagaggtggc |
106 |
Q |
| |
|
||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50732247 |
taaattacattaacttat-cagtgatgctatttccagtagttgattttggttctttatatatagcaaaacatggg-ttgatggaaaatagaagaggtggc |
50732344 |
T |
|
| Q |
107 |
cgacaaagttaatttaaactatcgtgatagccttgtgaacttctttgtcgataagtatagcattttcctt |
176 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
50732345 |
cgacaaagttactttaaactatcgtcatagccttgtgagcttctttgtcgagaagtatagcgttttcctt |
50732414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 238 - 271
Target Start/End: Original strand, 50732433 - 50732466
Alignment:
| Q |
238 |
atgcccttattctccttaatttaattattccttc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
50732433 |
atgcccttattctccttaatttaattattccttc |
50732466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University