View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5919_low_11 (Length: 299)
Name: NF5919_low_11
Description: NF5919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5919_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 280
Target Start/End: Original strand, 35973545 - 35973824
Alignment:
| Q |
1 |
gcgacagatcttcatcttttcacggaaacaacgttatgacgaccactgctacaattcgccgtccaaaaaccgttcctgatcttctatcttaccggaacaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973545 |
gcgagagatcttcatcttttcacggaaacaacgttatgacgaccactgctacaattcgccgtccaaaaaccgttcctgatcttctatcttaccggaacaa |
35973644 |
T |
 |
| Q |
101 |
cgtccttccggtgacggaaggtcttcctagacaaccaccgaagttgcttttgaaagtgacggttcttggaagccttggtcccgttcagatgctgatgaag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35973645 |
cgtccttccggtgacggaaggtcttcctagacaaccaccgaagttgcttttgaaagtgacggttcttggaagccttggtcctattcagatgctgatgaaa |
35973744 |
T |
 |
| Q |
201 |
ccggaatcaactgtcggcgatctagtggaaaccgccgtgcggcagtatatcaatgaagctcgccgtccaatcctgccttc |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973745 |
ccggaatcaactgtcggcgatctagtggaaaccgccgtgcggcagtatatcaatgaagctcgccgtccaatcctgccttc |
35973824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University