View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920-Insertion-14 (Length: 330)
Name: NF5920-Insertion-14
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920-Insertion-14 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 75 - 330
Target Start/End: Complemental strand, 16703901 - 16703646
Alignment:
| Q |
75 |
ttactacgttaaacaacaaagattacgttcacccgtaacttggggttacggctgtaatctcacattttaccctagggtattgacctagttgtccatttgg |
174 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703901 |
ttactacgttaaacaacaaggattacgttcacccgtaacttggggttacggctgtaatctcacattttaccctagggtattgacctagttgtccatttgg |
16703802 |
T |
|
| Q |
175 |
taggatcttctacccttaggccgtgccattctctttggagaatctcttcgtgtggctgaagcttttctccaacggttctcctcctatttatggtcttaat |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703801 |
taggatcttctacccttaggccgtgccattctctttggagaatctcttcgtgtggctgaagcttttctccaacggttctcctcctatttatggtcttaat |
16703702 |
T |
|
| Q |
275 |
ccctaaatgttgccctcagtcacttggggagtttcgttctatctatcttctaggtt |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703701 |
tcctaaatgttgccctcagtcacttggggagtttcgttctatctatcttctaggtt |
16703646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 16704013 - 16703950
Alignment:
| Q |
13 |
catggagccaaagtgaagatttagagctaaaagagatgtattcaagccttacaatatgtgcctt |
76 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16704013 |
catggagccaaagtgaagattttgagctaaaagagatgtattcaagccttacaatatgtgcctt |
16703950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University