View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920-Insertion-16 (Length: 125)
Name: NF5920-Insertion-16
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920-Insertion-16 |
 | |
|
| [»] chr3 (4 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 5e-60; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 9 - 125
Target Start/End: Complemental strand, 9857768 - 9857652
Alignment:
| Q |
9 |
ctcttcaacttcttcccattgatatcctccgtaatcatcttcacaataaacttcatactcatcatcttcttcaacctccatttcctcttcatcttcaaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9857768 |
ctcttcaacttcttcccattgatatcctccgtaatcatcttcacaataaacttcatactcatcatcttcttcaacctccatttcctcttcatcttcaaat |
9857669 |
T |
|
| Q |
109 |
tcatccaaaccattgtt |
125 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9857668 |
tcatccaaaccattgtt |
9857652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 24 - 104
Target Start/End: Complemental strand, 9857840 - 9857757
Alignment:
| Q |
24 |
ccattgatatcctccgtaatcatcttcacaataaacttcatactcatcatctt---cttcaacctccatttcctcttcatcttc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||| | |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
9857840 |
ccattgatatcctccgtaatcatcttcataattaacttcataataatcatcttcttcttcaacctccatttcctcttcaacttc |
9857757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 74 - 120
Target Start/End: Complemental strand, 9857892 - 9857846
Alignment:
| Q |
74 |
cttcttcaacctccatttcctcttcatcttcaaattcatccaaacca |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
9857892 |
cttcttcaacctccatttcctcttcatcttcatattcttccaaacca |
9857846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 24 - 65
Target Start/End: Complemental strand, 9857651 - 9857610
Alignment:
| Q |
24 |
ccattgatatcctccgtaatcatcttcacaataaacttcata |
65 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
9857651 |
ccattgatatcctcggtaatcatcttcaaaataaacttcata |
9857610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University