View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920-Insertion-17 (Length: 123)
Name: NF5920-Insertion-17
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920-Insertion-17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 4e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 4e-57
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 53487872 - 53487987
Alignment:
| Q |
8 |
aataattctaatgttgcatcctcttcttcattgtcagggttttttattttgaaaatgttcactgtgaacattcattctccttagcctcaaatcatcaaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53487872 |
aataattctaatgttgcatcctcttctttattgtcagggttttttattttgaaaatgttcactgtgaacattcattctccttagcctcaaatcatcaaag |
53487971 |
T |
|
| Q |
108 |
ttgtgatttggcttct |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
53487972 |
ttgtgatttggcttct |
53487987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University