View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920-Insertion-8 (Length: 491)
Name: NF5920-Insertion-8
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 403 - 491
Target Start/End: Complemental strand, 27447343 - 27447255
Alignment:
| Q |
403 |
aactcaatgcaatgcatcaaataaggatgcaaaagatgatagtcaaacaattactcgtcgagttgctaatttccaaccatcaatttgga |
491 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
27447343 |
aactcaatgcaatgcatcatctaaggatgcaaaagatgatagtcaaacaattactcgtcgctctgctaattctcaaccatcaatttgga |
27447255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University