View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920_high_11 (Length: 319)
Name: NF5920_high_11
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 10 - 303
Target Start/End: Original strand, 50666291 - 50666584
Alignment:
| Q |
10 |
gatgaatctgttgtgaatcgtgaattacgaattggtgtttagggttttaaaccttctttagatactttgatgaaattaaaccctcaatcacactaattat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50666291 |
gatgaatctgttgtgaatcgtgaattacgaattggtgtttagggttttaaaccttctttagatactttgatgaaattaaaccctcaatcacactaattat |
50666390 |
T |
 |
| Q |
110 |
tcaaatcttcacggtttaggggattagggtttaaaacctttgaataaattgctttgtttttagggattttgagaaattgaccttgttttgatataattct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50666391 |
tcaaatcttcacggtttaggggattagggtttaaaacctttgaataaattgctttgtttttagggattttgagaaattgaccttgttttgatataattct |
50666490 |
T |
 |
| Q |
210 |
ctaaacagaagttgctacgatgaaaaatacagagagcaaagatagagagtctcatgagacgaccaacatgtttggacatactgcgagcacaaac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50666491 |
ctaaacagaagttgctacgatgaaaaatatagagagcaaagatagagagtctcatgagacgaccaacatgtttggacatactgcgagcacaaac |
50666584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University