View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920_low_10 (Length: 336)
Name: NF5920_low_10
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 253; Significance: 1e-140; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 73 - 333
Target Start/End: Complemental strand, 16703901 - 16703641
Alignment:
| Q |
73 |
ttactacgttaaacaacaaagattacgttcacccgtaacttggggttacggctgtaatctcacattttaccctagggtattgacctagttgtccatttgg |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703901 |
ttactacgttaaacaacaaggattacgttcacccgtaacttggggttacggctgtaatctcacattttaccctagggtattgacctagttgtccatttgg |
16703802 |
T |
 |
| Q |
173 |
taggatcttctacccttaggccgtgccattctctttggagaatctcttcgtgtggctgaagcttttctccaacggttctcctcctatttatggtcttaat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703801 |
taggatcttctacccttaggccgtgccattctctttggagaatctcttcgtgtggctgaagcttttctccaacggttctcctcctatttatggtcttaat |
16703702 |
T |
 |
| Q |
273 |
ccctaaatgttgccctcagtcacttggggagtttcgttctatctatcttctaggttccttt |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16703701 |
tcctaaatgttgccctcagtcacttggggagtttcgttctatctatcttctaggttccttt |
16703641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 9 - 74
Target Start/End: Complemental strand, 16704015 - 16703950
Alignment:
| Q |
9 |
atcatggagccaaagtgaagatttagagctaaaagagatgtattcaagccttacaatatgtgcctt |
74 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16704015 |
atcatggagccaaagtgaagattttgagctaaaagagatgtattcaagccttacaatatgtgcctt |
16703950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University