View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5920_low_8 (Length: 355)
Name: NF5920_low_8
Description: NF5920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5920_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 10 - 339
Target Start/End: Original strand, 6801501 - 6801830
Alignment:
| Q |
10 |
aagaaaatcgattctttgaagatacggtgccgtttgatgacgatgaaactcaggcggtggatcttggtgatgaaactgaagtgtttgatgatattgctgg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6801501 |
aagaaaatcgattctttgaagatacggtgccgtttgatgacgatgaaactcaggcggtggatcttggtgatgaaactgaagtgtttgatgatattgctgg |
6801600 |
T |
|
| Q |
110 |
tgagactcagaagtttgatgattttgatacggagttgttgggtgaagggtatgaatctgatggaactgaggttttggaggatgtggatgatgagggtgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6801601 |
tgagactcagaagtttgatgattttgatacggagttgttgggtgaagggtatgaatctgatggaactgaggttttggaggatgtggatgatgagggtgtt |
6801700 |
T |
|
| Q |
210 |
gatgatcatcagtgtagggacagtggtgggtccgcggatcgtgaggatgatgttaatcgatcgattaatgagcgtagtagtgatgagaaacacacttctt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6801701 |
gatgatcatcagtgtagggacagtggtgggtccgcggatcgtgaggatgatgttaatcgatcgtttaatgagcgtagtagtgacgagaaacacacttctt |
6801800 |
T |
|
| Q |
310 |
ctggtaattgattacttttttaacactcat |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6801801 |
ctggtaattgattacttttttaacactcat |
6801830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 116 - 204
Target Start/End: Original strand, 6829776 - 6829863
Alignment:
| Q |
116 |
tcagaagtttgatgattttgatacggagttgttgggtgaagggtatgaatctgatggaactgaggttttggaggatgtggatgatgagg |
204 |
Q |
| |
|
||||||||| ||| ||||| ||||| |||| |||| ||||||||||||||||||||||||| | ||||| ||| ||||||||||||||| |
|
|
| T |
6829776 |
tcagaagttggat-atttttatacgcagttattggatgaagggtatgaatctgatggaactcaagttttcgagaatgtggatgatgagg |
6829863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University