View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921-Insertion-10 (Length: 393)
Name: NF5921-Insertion-10
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921-Insertion-10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 149 - 392
Target Start/End: Complemental strand, 445093 - 444858
Alignment:
| Q |
149 |
aacaattgatgacattcaaatacagatttaagtctgtctacatatatagttgcagatcataggggtggatatggatggaatcacatttcttgcgccaagc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
445093 |
aacaattgatgacattcaaatacagatttaagtctgtctacata----gttgcagatcataggggtggatatggatggcatcacatttcttgcgcc---- |
445002 |
T |
|
| Q |
249 |
taacaataaaaaatatgcatgcataaaataactacttttactccacttctttctcttgctctctgacttcttccctcttcttttcatcacataatgggaa |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
445001 |
taacaataaaaaatatgcatgcataaaataactacttttactccacttctttctcttgctctctgacttcttccctcttcttttcatcacataatgggaa |
444902 |
T |
|
| Q |
349 |
aaccagtctgaactctttcttctgttgtcataagagatacctgc |
392 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
444901 |
aaccagtctgaactctttcttccgttgtcataagagatacctgc |
444858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 17 - 51
Target Start/End: Complemental strand, 445195 - 445161
Alignment:
| Q |
17 |
caatttaacaatgtcattggccccatattggaatt |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
445195 |
caatttaacaatgtcattggccccatattggaatt |
445161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University