View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921-Insertion-13 (Length: 192)
Name: NF5921-Insertion-13
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921-Insertion-13 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 9 - 192
Target Start/End: Original strand, 506388 - 506571
Alignment:
| Q |
9 |
gtttaccacatttgtctatggtattgcaactaacaagcaggatgtcgcataaacaaaaatagaatgttcaatttcacttattaatatgtgcgcccccttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
506388 |
gtttaccacatttgtctatggtattgcaactaacaagcaggatgtcgcataaacaaaaatagaatgttcaatttcaattattaatatgtgcgcccccttt |
506487 |
T |
|
| Q |
109 |
tttctggtttttggtggtttaattgattggggtgtttcgcctgtatacggcaccctgatgtttttgtattgttgtttttattgg |
192 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
506488 |
tttctggtttttggtggtttatttgattggggtgtttcgcctatatacggcaccctgatgtttttgtattgttgtttttattgg |
506571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 95 - 187
Target Start/End: Original strand, 3595067 - 3595159
Alignment:
| Q |
95 |
tgtgcgcccccttttttctggtttttggtggtttaattgattggggtgtttcgcctgtatacggcaccctg-atgtttttgtattgttgttttt |
187 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| || | ||||||||| ||||| || | ||||||||| ||||||| ||||||||||||| |
|
|
| T |
3595067 |
tgtgccccccattttttctggtttttggtggttttatag-ttggggtgtgccgcctatagaaggcaccctgtttgtttttatattgttgttttt |
3595159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 92 - 187
Target Start/End: Original strand, 5179622 - 5179718
Alignment:
| Q |
92 |
atatgtgcgcccccttt-tttctggtttttggtggtttaattgattggggtgtttcgcctgtatacggcaccctg-atgtttttgtattgttgttttt |
187 |
Q |
| |
|
|||| ||||||||| || ||| ||||||||| |||||| || | |||||||||| ||||| |||||||||||||| || ||||||| |||||||||| |
|
|
| T |
5179622 |
atatttgcgcccccattgtttatggtttttgttggttttatgg-ttggggtgttccgcctatatacggcaccctgtttgattttgtactgttgttttt |
5179718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University