View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921-Insertion-14 (Length: 185)
Name: NF5921-Insertion-14
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921-Insertion-14 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 9 - 185
Target Start/End: Complemental strand, 3466257 - 3466075
Alignment:
| Q |
9 |
gagaagccattgaaatcaaaatcttgatcgaagaagaagaagattggaacacagagaattgtgatgtggttgagatttttgcgaaacaaaagtgagtttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3466257 |
gagaagccattgaaatcaaaatcttgatcgaagaagaagaagattggaacacagagaattgtgatgtggttgagatttttgcgaaacaaaagtgagtttt |
3466158 |
T |
|
| Q |
109 |
gaaagacagatggaggaacacgagtgaagttgtactt---cgaaacaaaaaatgccaacc---atgatggtgttccattcact |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
3466157 |
gaaagacagatggaggaacacgagtgaagttgtacttacacgaaacaaaaattgccaaccatgatgatggtgttccattcact |
3466075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University