View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921-Insertion-15 (Length: 105)
Name: NF5921-Insertion-15
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921-Insertion-15 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 3e-48; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 3e-48
Query Start/End: Original strand, 9 - 105
Target Start/End: Original strand, 4359085 - 4359181
Alignment:
| Q |
9 |
ccaccatggtggtgatgaaacatgaggttggtgatggcttttccggcgagcttgccgcggcgtttaaccatcatgttgaggtccatcattagttttc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4359085 |
ccaccatggtggtgatgaaacatgaggttggtgatggcttttccggcgagcttgccgcggcgtttaaccatcatgttgaggtccatcattagttttc |
4359181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 9 - 105
Target Start/End: Complemental strand, 4349799 - 4349703
Alignment:
| Q |
9 |
ccaccatggtggtgatgaaacatgaggttggtgatggcttttccggcgagcttgccgcggcgtttaaccatcatgttgaggtccatcattagttttc |
105 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4349799 |
ccaccgtggtggtgatgaaacatgaggttggtgatggcttttccggcgagcttgccgcggtgtttaaccatcatgttgaggtccatcattagttttc |
4349703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 73; E-Value: 7e-34
Query Start/End: Original strand, 9 - 105
Target Start/End: Complemental strand, 4353185 - 4353090
Alignment:
| Q |
9 |
ccaccatggtggtgatgaaacatgaggttggtgatggcttttccggcgagcttgccgcggcgtttaaccatcatgttgaggtccatcattagttttc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4353185 |
ccaccatggtggtgatgaaacatgaggttggtgatggcttttccggcaagctt-ctacggcgtttgaccatcatgttgaggtccatcattagttttc |
4353090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000002
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 43475487 - 43475548
Alignment:
| Q |
42 |
atggcttttccggcgagcttgccgcggcgtttaaccatcatgttgaggtccatcattagttt |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||||| ||| ||||||||||||| |
|
|
| T |
43475487 |
atggcttttccggcgagcttgctgcggcgtttgagcatcatgtttaggcccatcattagttt |
43475548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.000000000008
Query Start/End: Original strand, 42 - 105
Target Start/End: Original strand, 43486106 - 43486169
Alignment:
| Q |
42 |
atggcttttccggcgagcttgccgcggcgtttaaccatcatgttgaggtccatcattagttttc |
105 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||| | ||||||||| ||| ||||||| ||||||| |
|
|
| T |
43486106 |
atggcttttccggcaagcttgctgcggcgtttgagcatcatgtttaggcccatcatcagttttc |
43486169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University