View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921-Insertion-16 (Length: 58)
Name: NF5921-Insertion-16
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921-Insertion-16 |
 | |
|
| [»] chr5 (3 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 4e-18; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-18
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 4384764 - 4384813
Alignment:
| Q |
9 |
gttttcccgatccattctcttaacagcaatgacattacaagatgttgcta |
58 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4384764 |
gttttaccgatccattctcttaacagcaatgacattacaagatgttgcta |
4384813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 9 - 57
Target Start/End: Complemental strand, 4110445 - 4110397
Alignment:
| Q |
9 |
gttttcccgatccattctcttaacagcaatgacattacaagatgttgct |
57 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4110445 |
gttttaccgatccattctcttaacagcaatgacattacaagatgttgct |
4110397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 27; E-Value: 0.0000009
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 4107172 - 4107130
Alignment:
| Q |
15 |
ccgatccattctcttaacagcaatgacattacaagatgttgct |
57 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
4107172 |
ccgatccaatctcttaacagcaacaacattacaagacgttgct |
4107130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University