View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921-Insertion-6 (Length: 527)
Name: NF5921-Insertion-6
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 2e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 267 - 527
Target Start/End: Original strand, 1331175 - 1331428
Alignment:
| Q |
267 |
tcgttggttaatccctcggaaggttgtggaaaatgtagatcgtggtnnnnnnnnccc-gcatatgtttcaaagaaaacaattcataaatatgttgacaag |
365 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1331175 |
tcgttggttgatccctcggaagattgtggaaaatgtagatcatggtaaaaaaaaacctgcatatgtttcgaagaaaacaattcataaatatgttgacaag |
1331274 |
T |
|
| Q |
366 |
gagaatacatacggcatagcatcctccaaggcttttgaagcgcgggtgcaacacttgttattactcatgttgaaaattttgttgatgatgacgacattgt |
465 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1331275 |
gagaatgcatacggcatagcatcctccaaggcttttgaagtgc--------cacttgttattactcatgttgaaaattttgttgataatgacgacattgt |
1331366 |
T |
|
| Q |
466 |
tgatgcaaatgacgcgactcatgatggtactgatgacgttaatgttgatgcaattggtgtga |
527 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1331367 |
tgatgcaaatgacgcgactcatgatggtactgatgacgttaatgttgatgcaattggtgtga |
1331428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University