View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_high_30 (Length: 436)
Name: NF5921_high_30
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 141 - 325
Target Start/End: Complemental strand, 38108009 - 38107823
Alignment:
| Q |
141 |
tgagtatatttttatataaaatatagatatagatgcttatgaatgtttggatcggcttttcttcggtagatctgttcagtatgttggatcattttgttaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38108009 |
tgagtatatttttatataaaatatagatatagatgcttatgaatgtttggatcggcttttcttcggtggatctgttcagtatgttggatcattttgttaa |
38107910 |
T |
 |
| Q |
241 |
atatagtcatttattagatagattcaga--tgttgttctatcatgtggattatttagtgttcatacatatggtaatttagaaagaaa |
325 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||| ||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
38107909 |
gtatagtcatttattagatagattcggatgtgttgttctatcatgcggattatttggtgttcatgcatatggtaatttggaaagaaa |
38107823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 13 - 75
Target Start/End: Complemental strand, 38108137 - 38108075
Alignment:
| Q |
13 |
gtgagatgaaaataaggagaagaagataaatatgtagtaaccaataaaattctgatttgattg |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38108137 |
gtgagatgaaaataaggagaagaagataaatatgtagtaaccaataaaattctgatttgattg |
38108075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University