View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_high_32 (Length: 425)
Name: NF5921_high_32
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_high_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 5 - 402
Target Start/End: Original strand, 46039159 - 46039558
Alignment:
| Q |
5 |
tttcaatgagccacctcaacttagctgtagactgcggacggtagatgggggcatcacatggatgagctagacgcatgcatgaagtatcatgagttgtgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46039159 |
tttcaatgagccacctcaacttagctgtagactgcggacggtagatgggggcatcacatggatgagctagacgcatgcatgaagtatcatgagttgtgtt |
46039258 |
T |
 |
| Q |
105 |
gctttcataatacagtctaggaaaaaataagttattttgtcgcgagatcaattgtgcaaaagacaaagtgtgaa-ttttacagcttagatttacagctaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||| |
|
|
| T |
46039259 |
gctttcataatacagtctaggaaaaaataagttattttgtcgcgagatcaattgtgcaaaagacaaagtgtgaatttttacagcttagtgtaacagctaa |
46039358 |
T |
 |
| Q |
204 |
acttcattataaaattcactaaagagtttagaaattttcatctaaatcataaacagtgg----------aagtagcttttcatctaaacatcggtcacaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
46039359 |
acttcattataaaattcactaaagagtttagaaattttcatctaaatcataaacagtggaaattagtataagtagcttttcatctaaacatcggtcacaa |
46039458 |
T |
 |
| Q |
294 |
aattaaccnnnnnnnttgaccagaaaataacccacaaaacacctcggtacaggcttaatatcaattttgtcaaaattatatattcaacactatgaaaatg |
393 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46039459 |
aattaacca---------accagaaaataacccacaaaacacctcggtacaggcttaatatcaattttgtcaaaattatatattcaacactatgaaaatg |
46039549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University