View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_high_48 (Length: 350)
Name: NF5921_high_48
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_high_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 159 - 303
Target Start/End: Complemental strand, 445093 - 444957
Alignment:
| Q |
159 |
aacaattgatgacattcaaatacagatttaagtctgtctacatatatagttgcagatcataggggtggatatggatggaatcacatttcttgcgccaagc |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
445093 |
aacaattgatgacattcaaatacagatttaagtctgtctacata----gttgcagatcataggggtggatatggatggcatcacatttcttgcgc----c |
445002 |
T |
|
| Q |
259 |
taacaataaaaaatatgcatgcataaaataactacttttactcca |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
445001 |
taacaataaaaaatatgcatgcataaaataactacttttactcca |
444957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 27 - 61
Target Start/End: Complemental strand, 445195 - 445161
Alignment:
| Q |
27 |
caatttaacaatgtcattggccccatattggaatt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
445195 |
caatttaacaatgtcattggccccatattggaatt |
445161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University