View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5921_high_65 (Length: 267)
Name: NF5921_high_65
Description: NF5921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5921_high_65 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 3466254 - 3466011
Alignment:
| Q |
1 |
aagccattgaaatcaaaatcttgatcgaagaagaagaagattggaacacagagaattgtgatgtggttgagatttttgcgaaacaaaagtgagttttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3466254 |
aagccattgaaatcaaaatcttgatcgaagaagaagaagattggaacacagagaattgtgatgtggttgagatttttgcgaaacaaaagtgagttttgaa |
3466155 |
T |
|
| Q |
101 |
agacagatggaggaacacgagtgaagttgtactt---cgaaacaaaaaatgccaacc---atgatggtgttccattcactcctttgctatttcccatttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3466154 |
agacagatggaggaacacgagtgaagttgtacttacacgaaacaaaaattgccaaccatgatgatggtgttccattcactcttttgctatttcccatttt |
3466055 |
T |
|
| Q |
195 |
gcccccactagtttctttgattaaacaatcaaattggtcttgcc |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3466054 |
gcccccaccagtttctttgattaaacaatcaaattggtcttgcc |
3466011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University